ID: 1108586639 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:51875714-51875736 |
| Sequence | CCTGATCAGCAGCGCCTGCA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1108586639_1108586642 | 9 | Left | 1108586639 | 13:51875714-51875736 | CCTTGCAGGCGCTGCTGATCAGG | No data | ||
| Right | 1108586642 | 13:51875746-51875768 | CAAGCCCACATACAGCCTCCTGG | No data | ||||
| 1108586639_1108586645 | 14 | Left | 1108586639 | 13:51875714-51875736 | CCTTGCAGGCGCTGCTGATCAGG | No data | ||
| Right | 1108586645 | 13:51875751-51875773 | CCACATACAGCCTCCTGGTCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1108586639 | Original CRISPR | CCTGATCAGCAGCGCCTGCA AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||