ID: 1108586639

View in Genome Browser
Species Human (GRCh38)
Location 13:51875714-51875736
Sequence CCTGATCAGCAGCGCCTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108586639_1108586642 9 Left 1108586639 13:51875714-51875736 CCTTGCAGGCGCTGCTGATCAGG No data
Right 1108586642 13:51875746-51875768 CAAGCCCACATACAGCCTCCTGG No data
1108586639_1108586645 14 Left 1108586639 13:51875714-51875736 CCTTGCAGGCGCTGCTGATCAGG No data
Right 1108586645 13:51875751-51875773 CCACATACAGCCTCCTGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108586639 Original CRISPR CCTGATCAGCAGCGCCTGCA AGG (reversed) Intergenic
No off target data available for this crispr