ID: 1108587775

View in Genome Browser
Species Human (GRCh38)
Location 13:51885742-51885764
Sequence CAAAGGGAAGTGCCTAGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108587775_1108587781 -1 Left 1108587775 13:51885742-51885764 CCCCTCCTAGGCACTTCCCTTTG No data
Right 1108587781 13:51885764-51885786 GTATATAGACAGTCAGACTCTGG No data
1108587775_1108587782 7 Left 1108587775 13:51885742-51885764 CCCCTCCTAGGCACTTCCCTTTG No data
Right 1108587782 13:51885772-51885794 ACAGTCAGACTCTGGTCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108587775 Original CRISPR CAAAGGGAAGTGCCTAGGAG GGG (reversed) Intergenic
No off target data available for this crispr