ID: 1108594727

View in Genome Browser
Species Human (GRCh38)
Location 13:51939659-51939681
Sequence TCTTAGCTATAGAAGCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 150}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108594724_1108594727 17 Left 1108594724 13:51939619-51939641 CCTGCAGAAAACATTTCGGCAGA 0: 1
1: 0
2: 1
3: 6
4: 128
Right 1108594727 13:51939659-51939681 TCTTAGCTATAGAAGCAGGAGGG 0: 1
1: 0
2: 1
3: 9
4: 150
1108594722_1108594727 29 Left 1108594722 13:51939607-51939629 CCTTCGTCTTTTCCTGCAGAAAA 0: 1
1: 0
2: 2
3: 16
4: 237
Right 1108594727 13:51939659-51939681 TCTTAGCTATAGAAGCAGGAGGG 0: 1
1: 0
2: 1
3: 9
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108594727 Original CRISPR TCTTAGCTATAGAAGCAGGA GGG Intronic
902037167 1:13466430-13466452 TCTTAGCTCCAGAAGCCAGAGGG + Intergenic
903368166 1:22817678-22817700 TCTGAGCTCTAGAAGAATGAGGG - Intronic
903391241 1:22964909-22964931 TCTTAGATACAGCTGCAGGAAGG + Intronic
903710877 1:25323210-25323232 TCTTAGCTAAGAAAGCCGGAGGG - Intronic
903716069 1:25368219-25368241 TCTTAGCTAAGAAAGCCGGAGGG + Intronic
905092047 1:35437459-35437481 TGAAAGCTAGAGAAGCAGGATGG - Intronic
905543908 1:38782454-38782476 TCCTTGCTATAGAAACAAGAGGG + Intergenic
908241974 1:62195446-62195468 TCCTAGCTTTAGAAAAAGGATGG + Intronic
908633183 1:66133147-66133169 ACTCAGATACAGAAGCAGGAAGG + Intronic
911138873 1:94475351-94475373 TCTTAGGTACAGAAGCATGTTGG + Intronic
913276614 1:117144437-117144459 TCTTAGCTGTCCACGCAGGATGG + Exonic
915187013 1:154114709-154114731 TCCTAGCTACTGAGGCAGGAGGG - Intronic
920711756 1:208302085-208302107 TGTTATCTCTAGAAGCAGGCAGG - Intergenic
922869658 1:228891822-228891844 TCTTAGCCAAAGCAGCAGGAGGG - Intergenic
1063737357 10:8774482-8774504 TCTTGGCTATAAAAACATGACGG + Intergenic
1064321492 10:14309670-14309692 TGTTAGATATGGAGGCAGGAGGG - Intronic
1065282274 10:24151627-24151649 TCTTAGCTCAAGAAACAGTATGG + Intronic
1067516451 10:46950157-46950179 TCTAAGCTAAATAACCAGGAAGG - Intronic
1067645801 10:48101636-48101658 TCTAAGCTAAATAACCAGGAAGG + Intergenic
1068586973 10:58810616-58810638 TCTGAGCTATAGAAGAATAAAGG - Intronic
1069166206 10:65163647-65163669 TGTTAGCTTTAGAATCTGGAGGG - Intergenic
1069880109 10:71587197-71587219 TGTGAGTTTTAGAAGCAGGAAGG - Intronic
1072218584 10:93308695-93308717 TCGTAGCCATACAAGCAGCAGGG - Intronic
1074138781 10:110652633-110652655 TCTTACCTAGAAAAACAGGAAGG - Intronic
1074214355 10:111369766-111369788 TCTTTGTTATAGAAGCAGGAGGG + Intergenic
1075529748 10:123219307-123219329 TCTTCGCAATGGAAGTAGGATGG + Intergenic
1078665671 11:13323135-13323157 TGTCAGCTGTAGAAGTAGGAAGG + Intronic
1083258859 11:61512489-61512511 TCTTAGACACAGAAGCAGCAGGG + Intergenic
1085483839 11:76845154-76845176 TCTTATCTATAAAATGAGGATGG + Intergenic
1086573023 11:88306634-88306656 TCTCAGCCAGAGAAGGAGGATGG - Intronic
1089351932 11:117826295-117826317 TCTTGGCTCCAGAAGCAGAAGGG - Intronic
1090573178 11:128069813-128069835 TCTTAGAGATAGAAGTAGAATGG - Intergenic
1090867383 11:130713624-130713646 TCTTATCTAGAGACGCATGACGG - Intronic
1095585729 12:43847337-43847359 TTTGAGGTATAGAAACAGGAAGG + Intronic
1096828448 12:54296829-54296851 TCTAAGCTATCCAAGCAGAAAGG - Intronic
1097755917 12:63406626-63406648 TATTATCTATAGAAGCAGTTGGG + Intergenic
1101400780 12:104384858-104384880 TCTTGGTTATATAAGCAGGTAGG - Intergenic
1103795869 12:123502795-123502817 TCATAGCTCTAGAAGCCAGAAGG + Intronic
1107250260 13:38351112-38351134 TCTTAACTATATAAGGAGTAAGG - Intronic
1108594727 13:51939659-51939681 TCTTAGCTATAGAAGCAGGAGGG + Intronic
1110449889 13:75629579-75629601 TCGTGGTTAGAGAAGCAGGAAGG + Intronic
1110853911 13:80276725-80276747 TCTGAGCTATAGAACCATGGGGG + Intergenic
1112195237 13:97219300-97219322 GCTAAGCTAGAGAAGCAGGCAGG + Intergenic
1115407172 14:33030369-33030391 TCTAAGCTACAGAAATAGGAAGG - Intronic
1116825604 14:49670527-49670549 TCCTATCTATAGAAGGGGGAAGG - Intronic
1116853114 14:49927808-49927830 TCTTGGCTACAGCAACAGGATGG - Intergenic
1118787272 14:69056297-69056319 TGTTAGCTATAGGAGTAGGTAGG + Intronic
1119844918 14:77822080-77822102 TCTAAGCTCTAGAAGCACGGGGG - Intronic
1120281572 14:82445048-82445070 TCTTAGCTTGGGAACCAGGATGG + Intergenic
1122299832 14:100725313-100725335 TCTTAGCCATAGATGTGGGAAGG - Intergenic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1132541821 16:513686-513708 TCTTAGCTTTAAGAGCTGGAAGG - Intronic
1135425796 16:22334958-22334980 TTTTAGCTATAGAATCACTAAGG + Exonic
1135927007 16:26704031-26704053 TCTTACCTTAAGAAGCTGGAAGG + Intergenic
1136376407 16:29868067-29868089 TCTGGGGTAGAGAAGCAGGACGG + Intergenic
1137913507 16:52403471-52403493 TTTTAGCTATAGGAAGAGGAAGG + Intergenic
1143642877 17:8209511-8209533 TCTTGGCTGCAGAAGAAGGAAGG - Intronic
1144320454 17:14112881-14112903 ATTTGGCTAAAGAAGCAGGAGGG + Intronic
1146645325 17:34573371-34573393 TCTTATCTATAAAAATAGGAAGG + Intergenic
1147681328 17:42248842-42248864 TACTAGCTGCAGAAGCAGGAGGG - Intronic
1148605579 17:48926845-48926867 TCTGAGCCATGGGAGCAGGAAGG - Intronic
1148686584 17:49504329-49504351 TCTGAGCTATACAAACAAGAGGG - Intronic
1154093060 18:11382775-11382797 TCTTAGCTATAGGAGGAAAATGG + Intergenic
1155216249 18:23645592-23645614 TCTAATCTAGAGAAGCAGAAGGG - Intronic
1160475015 18:79175430-79175452 TAATACCTATAGAGGCAGGAAGG - Intronic
1166295421 19:41887148-41887170 ACGGAGCTACAGAAGCAGGAAGG + Intronic
927259052 2:21068466-21068488 ACCTAGCTACAGAAGGAGGATGG - Intergenic
929764630 2:44833851-44833873 TCTTAGCCATTGTAGCAGGATGG + Intergenic
930166826 2:48211198-48211220 CCTTAGCCTTAGAAGCAGGCTGG - Intergenic
930461239 2:51679629-51679651 TAATAGCTAAAGAAGCAGGCGGG + Intergenic
933607141 2:84395163-84395185 CTTTATCTATTGAAGCAGGATGG - Intergenic
934653412 2:96104846-96104868 TCTCAGCTGCAGAAACAGGATGG - Intergenic
936750536 2:115635672-115635694 TCTTAGCTCTAGAAGCCCAATGG + Intronic
939561857 2:143741920-143741942 TCTAAGTTATAGAAAAAGGAAGG + Intronic
940829476 2:158452433-158452455 TCTTAGACAGAAAAGCAGGAGGG + Intronic
941042740 2:160641651-160641673 TCTTAGATATTGAAGTTGGAGGG - Intergenic
941246175 2:163100172-163100194 TCTCAACTATAGAAGCCAGATGG + Intergenic
941662411 2:168208807-168208829 TGTTATCTCTAGCAGCAGGAGGG - Intronic
945936752 2:215910060-215910082 TCTTAGCCATAGAACCTAGATGG + Intergenic
946762857 2:223012416-223012438 TCTTAGCAAGAGGAGCAGGTGGG - Intergenic
1169932429 20:10848944-10848966 TCTTTGCTGTAAAAGCTGGAAGG - Intergenic
1170922082 20:20688629-20688651 ACTGAGGTATAGAAGTAGGAGGG - Intronic
1171399232 20:24860954-24860976 ACTTAGCTAGTGCAGCAGGAGGG - Intergenic
1171433291 20:25100729-25100751 TCATAGCTATCTACGCAGGATGG - Intergenic
1174623538 20:51895428-51895450 TGTTAGCAATAGAAGAAGGAAGG - Intergenic
1175686522 20:61032295-61032317 TGTTTGCTATTGAATCAGGACGG - Intergenic
1177686254 21:24440721-24440743 TAAGAGCTATAGCAGCAGGAAGG + Intergenic
1177958541 21:27631733-27631755 TCTCAGCTATATAAGAAGGAAGG - Intergenic
1179016247 21:37596288-37596310 TCTTAGCGATGGAAGCAATATGG + Intergenic
1179953121 21:44722928-44722950 TCATAGCTAGAGATGCAGGAAGG - Intergenic
1181591256 22:23886355-23886377 TCTTAGTTATAGCAGCCCGACGG - Intronic
1182314098 22:29432106-29432128 TCTTAGCTAAGAAAGCTGGATGG + Intergenic
1184480900 22:44746257-44746279 TCTTAGCTCAAGAAGCTGGCAGG + Intronic
951738100 3:25889896-25889918 ACTTGGCTATACAAGCAGGTGGG + Intergenic
955009705 3:55002220-55002242 TCATAGCCATGGATGCAGGATGG - Intronic
959080386 3:101794692-101794714 TCTTGGGTAGAGAAGGAGGAAGG + Intronic
959202538 3:103266878-103266900 GCTTCACTAAAGAAGCAGGAAGG + Intergenic
962326554 3:134438803-134438825 TCTTAGCTATAGACAAAGGTGGG + Intergenic
966270547 3:178099269-178099291 TCTTAACTCTAGATCCAGGAAGG + Intergenic
968179272 3:196579332-196579354 TCTGAGGTATAAAAGCTGGAAGG + Intronic
970884071 4:20967054-20967076 ACTTAGTTGTAGAAGCAGAATGG - Intronic
972860269 4:43160020-43160042 TCTTAACTTTAGAAGAAGAAAGG - Intergenic
972981159 4:44703779-44703801 TCTTAGCTATGGAAGCTGCTTGG + Intronic
973062292 4:45742503-45742525 TCTTAGCTCTGGAAGTAGAAAGG - Intergenic
979202719 4:117997739-117997761 TCTTTGCTTGAGAAGCAGCATGG + Intergenic
980432843 4:132726912-132726934 TCTTAGCTCTGGAAGGAAGAGGG - Intergenic
981477205 4:145198926-145198948 ACTTAGCCAGAGAAGGAGGAGGG - Intergenic
982193954 4:152890555-152890577 TCTTTGCAATAGCAGCATGAAGG + Intronic
984129536 4:175856675-175856697 ACTGAGCGATGGAAGCAGGATGG + Intronic
988550346 5:32195313-32195335 TCTTAGCTCTTGAAGGAGGATGG + Intergenic
993537478 5:89104634-89104656 CATTTGCTATAGAACCAGGAAGG + Intergenic
993889821 5:93460226-93460248 TCTTAGGTACAGACTCAGGAAGG + Intergenic
998735198 5:145129914-145129936 TCTTATAGATAGAAGAAGGATGG - Intergenic
1000486163 5:161847503-161847525 TCTAAGCTACAGAAGAAGGTGGG + Intronic
1004476131 6:15973839-15973861 TCTTAGCTATATATCTAGGAGGG + Intergenic
1006836484 6:37002113-37002135 TGTTAGCCATGGATGCAGGAGGG - Intergenic
1008435295 6:51468831-51468853 TGTAGGCAATAGAAGCAGGAAGG + Intergenic
1008673084 6:53793764-53793786 TTTTAGCTATAGCAGCTGGAGGG + Intergenic
1011412682 6:87082309-87082331 GCTCAGCTATATAAGCAGCAAGG - Intergenic
1014188204 6:118459670-118459692 TCTTAGAAATAAGAGCAGGAAGG - Intergenic
1015703352 6:136060150-136060172 GATTAGCTAAAGAAGAAGGAGGG - Intronic
1016260918 6:142169544-142169566 TTTTAGCTAAAGAAGCAGTTGGG + Exonic
1019782056 7:2946545-2946567 TCTGAGATATAGAAGAAGAAAGG + Intronic
1020847735 7:13308268-13308290 TCTTAAAAATAAAAGCAGGATGG + Intergenic
1022841365 7:34167111-34167133 TCTTAGATATAGAAAAAGGACGG - Intergenic
1024288083 7:47777673-47777695 TCTTTGTTATAGCAGCAGCATGG - Intronic
1025739942 7:64186396-64186418 TGTCACCTGTAGAAGCAGGATGG + Intronic
1027364962 7:77447780-77447802 TCTTAGGGACAGAAACAGGATGG + Intergenic
1027512485 7:79100197-79100219 TATTAGCCATAGAAGTAGAATGG + Intronic
1028002307 7:85514723-85514745 AGTTAGCTTTAGAAGCAAGATGG - Intergenic
1028163294 7:87509893-87509915 TCTTAACTGAAGAAGAAGGAGGG + Intronic
1028741734 7:94283174-94283196 TCTTAGGTATAGAAGAACAAGGG - Intergenic
1028772010 7:94636745-94636767 TCTTAGCTAAAGCGGTAGGATGG - Intronic
1030798792 7:113823676-113823698 TCTCATCTATAGAAGCTGCAGGG - Intergenic
1034761040 7:153672097-153672119 TCTAAGCCATAGCAGTAGGATGG + Intergenic
1035267773 7:157701276-157701298 TCTTAGCTACAGACTCAGGCAGG + Intronic
1038818557 8:30931458-30931480 TCTTAGCTCTGGGAGCAGAAGGG - Intergenic
1039884342 8:41646755-41646777 GTTTAGCTGTAAAAGCAGGATGG - Intronic
1041324360 8:56649260-56649282 TGTAAGCTAAAGAACCAGGAAGG - Intergenic
1041563937 8:59253774-59253796 TATTAGCTATAGAATCTGTACGG + Intergenic
1042279140 8:67036385-67036407 CCTTAGAAATATAAGCAGGAGGG + Intronic
1044801562 8:95962333-95962355 CGTTAGCTATAGAAGTAGCAGGG - Intergenic
1046048659 8:108993995-108994017 GTTTAGCTTTAGAATCAGGAGGG - Intergenic
1046881620 8:119315421-119315443 TCTTAGCAATATAAGCAAGATGG - Intergenic
1049983873 9:930178-930200 ACATAGCTATAGAGGTAGGATGG + Intronic
1050323407 9:4477325-4477347 TCATAGATACAGAAGTAGGATGG + Intergenic
1055118753 9:72634305-72634327 TTTTATCTATAGGAGCAAGAGGG + Intronic
1055781132 9:79822905-79822927 GTTCAGCTATAGCAGCAGGAGGG + Intergenic
1060836011 9:126755611-126755633 TCTTTGGTATAGAAGAAAGACGG + Intergenic
1060907773 9:127323406-127323428 ACTCAGCTGTAGAGGCAGGAGGG - Intronic
1187044845 X:15637100-15637122 TCTTCTCCATAGAAGCAGAATGG + Intronic
1188023566 X:25185248-25185270 TCAAAGCATTAGAAGCAGGAAGG + Intergenic
1188036529 X:25323836-25323858 TTTTAGCTATATAACCAGCAGGG - Intergenic
1190558485 X:51663189-51663211 TCTTATCTATAAAAGCAAGCAGG - Intergenic
1193647652 X:84088877-84088899 TCCCAGTTATAGAAGCAGTATGG + Intronic
1193741522 X:85223093-85223115 GCTTAGCCATAGAAGAAAGAGGG - Intergenic
1198397810 X:136239555-136239577 TCTTAACTATAAAACAAGGAAGG + Intronic
1199058133 X:143321472-143321494 TCTTATCTATCAAAGGAGGAGGG + Intergenic
1199314315 X:146359234-146359256 TCTTAGCAAAATAAGCATGAGGG + Intergenic
1201283739 Y:12361936-12361958 TCTTAGCTGAAAAAGCTGGATGG - Intergenic
1201297708 Y:12478524-12478546 TCTTAGCTGAAAAAGCCGGACGG - Intergenic