ID: 1108598048

View in Genome Browser
Species Human (GRCh38)
Location 13:51966698-51966720
Sequence GTGCAGAGCAGGGTCTACGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 1, 2: 1, 3: 12, 4: 102}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108598048_1108598061 24 Left 1108598048 13:51966698-51966720 CCGACGTAGACCCTGCTCTGCAC 0: 1
1: 1
2: 1
3: 12
4: 102
Right 1108598061 13:51966745-51966767 GCCACAGTTCAGCAGCTGGAAGG 0: 6
1: 3
2: 2
3: 27
4: 190
1108598048_1108598052 2 Left 1108598048 13:51966698-51966720 CCGACGTAGACCCTGCTCTGCAC 0: 1
1: 1
2: 1
3: 12
4: 102
Right 1108598052 13:51966723-51966745 CAGCCCGCCCGCACCCACCATGG 0: 4
1: 0
2: 3
3: 20
4: 216
1108598048_1108598060 20 Left 1108598048 13:51966698-51966720 CCGACGTAGACCCTGCTCTGCAC 0: 1
1: 1
2: 1
3: 12
4: 102
Right 1108598060 13:51966741-51966763 CATGGCCACAGTTCAGCAGCTGG 0: 7
1: 1
2: 1
3: 25
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108598048 Original CRISPR GTGCAGAGCAGGGTCTACGT CGG (reversed) Intronic
900184906 1:1328450-1328472 GTGCCGTGCAGGGGCTACGGAGG - Exonic
900410015 1:2508181-2508203 GTTCCTAGCAGGGTCCACGTCGG + Intergenic
900810120 1:4795541-4795563 GTGCATAGCAGGGTGTTCGATGG - Intergenic
904980233 1:34494527-34494549 GTGCAGAGGAGGATATATGTAGG - Intergenic
909380836 1:74996632-74996654 TTGCAGAGCAGGATCTAGGTAGG + Intergenic
914753387 1:150550176-150550198 GTCCAGACCAGGGTCTACTCTGG + Intronic
917449598 1:175136069-175136091 GTGCCGAGCAGGGTGTTGGTGGG + Intronic
917506830 1:175634987-175635009 GAGCAGAGGAGGGGCTAGGTAGG - Intronic
919753313 1:201051846-201051868 GTGCAGAGCTGGGGCGAGGTGGG + Intronic
922554594 1:226523027-226523049 GTCCACGGGAGGGTCTACGTGGG - Intergenic
1063176355 10:3554194-3554216 ATGCAGAGCAGAGTCTAGGAAGG + Intergenic
1063576575 10:7266859-7266881 GTGCAGAGAAGGGTTCACCTGGG + Intronic
1067945685 10:50686722-50686744 GGGCAGAGCAGGGGCTGCCTGGG + Intergenic
1069531888 10:69225778-69225800 CTGCAGAGCTGTGGCTACGTGGG - Intronic
1070867198 10:79713595-79713617 GGGCAGAGCAGGGGCTGCCTGGG + Intronic
1070880990 10:79851719-79851741 GGGCAGAGCAGGGGCTGCCTGGG + Intergenic
1071562966 10:86657477-86657499 GTGCAGGGCAGGGTCCAGGCAGG + Intronic
1071634113 10:87235819-87235841 GGGCAGAGCAGGGGCTGCCTGGG + Intronic
1071647561 10:87368036-87368058 GGGCAGAGCAGGGGCTGCCTGGG + Intronic
1076294672 10:129375320-129375342 GTGCAGAGCAGGGGCTGACTTGG + Intergenic
1077897429 11:6463970-6463992 GTGCAGAGCCAGGTTTCCGTTGG + Intronic
1078759245 11:14238488-14238510 GTGCAGAGGAGGGTCAGCGTGGG + Intronic
1081809949 11:45909076-45909098 GTCCAGAGCGGGGTCTAGCTTGG - Intergenic
1083023667 11:59531926-59531948 TTGCAGAGCAGGAAGTACGTGGG - Intergenic
1083044038 11:59716265-59716287 ATGCAGCGCAGGGTCTGCGTTGG + Intronic
1083261126 11:61523735-61523757 GTGGAGAGCAGGGTCTGCAGTGG - Intronic
1090791697 11:130095574-130095596 CTGCAGAGCAGGCTCCACTTGGG + Intronic
1091829930 12:3542380-3542402 GTGGAGAGCAGGGTCAAGGAAGG - Intronic
1092262539 12:6960244-6960266 GTGCAGAGCAGGGCCTGGGGGGG + Intronic
1101774165 12:107778567-107778589 GTGCAAAGCAGGAGCTGCGTTGG + Intergenic
1101817441 12:108156426-108156448 GTGCATAGTAGGGTCTTCATAGG + Intronic
1108598048 13:51966698-51966720 GTGCAGAGCAGGGTCTACGTCGG - Intronic
1113637094 13:111927068-111927090 GAGCAGAGCAGGGTCCCAGTAGG + Intergenic
1119911166 14:78350472-78350494 GGCCAGAGCAGGGTATGCGTGGG + Intronic
1122309590 14:100786043-100786065 GTGCAGTGCAGGGAGTATGTTGG + Intergenic
1123579623 15:21704290-21704312 TCTCAGAGAAGGGTCTACGTGGG - Intergenic
1123616250 15:22146801-22146823 TCTCAGAGAAGGGTCTACGTGGG - Intergenic
1124358701 15:29018559-29018581 GTGCAGAGCAGGATCCAGGAGGG + Intronic
1124868897 15:33521219-33521241 GTGCAAAGCAGAATCTAAGTTGG + Intronic
1125342665 15:38689926-38689948 GTGCAGAGGAGGGTCTTTGAAGG + Intergenic
1129390892 15:75220485-75220507 GTGCCCTGCAGGGTCTACCTTGG + Intergenic
1129731646 15:77935786-77935808 GTGCCCTGCAGGGTCTACCTTGG - Intergenic
1130345868 15:83044324-83044346 ATGCAGAGCAGGGTTGCCGTCGG - Intronic
1130616599 15:85415183-85415205 GTGCAGAGCGGGGTCTGCGTCGG - Intronic
1131133001 15:89912303-89912325 GTCCAGAGCAGGGCCTGCCTGGG - Intronic
1202988493 15_KI270727v1_random:438535-438557 TCTCAGAGAAGGGTCTACGTGGG - Intergenic
1132656840 16:1044989-1045011 TGGCAGGGCAGGGTCTACGCAGG - Intergenic
1132788413 16:1671074-1671096 GCGCAGAGCAGGGTCTCTGAAGG + Intronic
1133229439 16:4359690-4359712 GAACAGAGCAGGGGCTACGTGGG - Intronic
1137359268 16:47798015-47798037 GTGCAGAGCAGTAGCCACGTGGG + Intergenic
1139510896 16:67428058-67428080 GTGCAGGGCAGGGGCTCCTTGGG + Intergenic
1145260390 17:21351396-21351418 GTGCAGAGCAGTGTCCACACAGG - Intergenic
1145316230 17:21736545-21736567 GTGCAGAGCAGTGTCCACACAGG + Intergenic
1145714659 17:27008473-27008495 GTGCAGAGCAGTGTCCACACAGG + Intergenic
1145995380 17:29102104-29102126 GGGCAGAGCTGGGTCAACATTGG - Intronic
1148800337 17:50221103-50221125 GAGCAGGGCAGGGTCTGCGCTGG - Intergenic
1150559265 17:66280878-66280900 TTGCAGGACAGGGTCTAGGTGGG + Intergenic
1151961117 17:77406073-77406095 GTGCAGGGCAGGGTCTCCTGGGG + Intronic
1152330728 17:79671123-79671145 GAGCAGAGCAGGGTGTCCATGGG + Intergenic
1153488700 18:5628197-5628219 CGGTAGAGCAGGGTCTATGTGGG - Intronic
1160847765 19:1173958-1173980 GGGCAGCGCGGGGTCAACGTTGG + Intronic
1160883691 19:1334706-1334728 ATGCAGAGCGGGGTCTCCGGAGG + Intergenic
1160980116 19:1812758-1812780 GCGCAGAGCAGGGTCAGGGTAGG + Intergenic
1161434015 19:4251088-4251110 GTGCAGAACGAGGTCTACCTGGG + Exonic
1162321889 19:9975448-9975470 GTTCAGAGCTGGGTTTAGGTTGG + Intronic
1165772067 19:38385807-38385829 GGGCAGAGCAGGGGCTGCGGTGG + Exonic
1168136873 19:54357622-54357644 GTGCAGAGGAGGGTGAAGGTTGG - Intronic
1168161209 19:54511469-54511491 GTGCAGAGGAGGGTGAAGGTTGG + Intergenic
925616817 2:5751583-5751605 GTGCACAGCAGGGGCTGCGTGGG + Intergenic
926063546 2:9820006-9820028 GTGAAGAGCAGGCTCCAGGTTGG - Intergenic
929996477 2:46829256-46829278 GTGCAGGGCAGGGTTGACCTTGG - Intronic
932403690 2:71499888-71499910 GTGCAGAGCAGAGCCTACATGGG - Intronic
933945607 2:87283811-87283833 GGGCAGAGCAGGGTGTGCGTGGG - Intergenic
936334604 2:111577775-111577797 GGGCAGAGCAGGGTGTGCGTGGG + Intergenic
940011172 2:149057368-149057390 GTGCAGGGCAGGGTCAGGGTGGG - Intronic
941916517 2:170817185-170817207 GTGGAGAGCAGGGACTAGGGCGG - Intronic
943300571 2:186192400-186192422 GTGAAGAGTAGGATCTACTTTGG - Intergenic
1169691160 20:8333783-8333805 GTGCAGAGCAGGGGCCACACAGG - Intronic
1171108524 20:22458956-22458978 GTGCAGAGCACTGTGTACCTGGG + Intergenic
1172424981 20:34849934-34849956 GTGCAGAGCAGAGACCTCGTGGG - Intronic
1176289585 21:5037072-5037094 GTGCAGGGCAGGGTCTCTGAGGG - Intronic
1179867645 21:44226515-44226537 GTGCAGGGCAGGGTCTCTGAGGG + Intronic
1179940696 21:44637523-44637545 GTGCAGACCAGGGTCAAGCTGGG - Exonic
1179994455 21:44967534-44967556 GAGCACAGCAGGGTCTCTGTGGG - Intronic
1180091268 21:45534887-45534909 GTGGAGAGCAGGGCCGACGCTGG - Intronic
1180558344 22:16595510-16595532 GTGCAGAGCAGGGTCTGCGTCGG + Intergenic
1181136268 22:20768739-20768761 GTGCAGGGCAGGCTCTGGGTAGG + Intronic
1181922705 22:26333190-26333212 GCCCAGAGCAGGGTCAAGGTGGG + Intronic
1182149978 22:28021076-28021098 TGGCAGAGAAGCGTCTACGTGGG + Intronic
956630393 3:71311408-71311430 GTACAGAGCAGTGGCTACGCAGG + Intronic
960549723 3:118961300-118961322 GAGCAGAGCAGGCTCTATGCAGG - Intronic
960941495 3:122937909-122937931 GTGCAGAGGAGGTTCAAAGTGGG - Intronic
961692585 3:128680775-128680797 ATGCAGAGCTGGGGCGACGTGGG - Intronic
979519502 4:121650321-121650343 GTGCAGATCAGGGTTTTGGTTGG - Intergenic
982529159 4:156516885-156516907 GTGCAGCGCAGTGTTTACTTAGG + Intergenic
985894657 5:2741032-2741054 GTGCAGAGCCGGGTGCACGCGGG + Intergenic
989155793 5:38343642-38343664 GTGCAGAGCAGGGTGGAGGGAGG - Intronic
998116720 5:139543449-139543471 GTGCAATCCAGGATCTACGTGGG - Intronic
1003071252 6:2947212-2947234 GTGCAGAGCAGGGAGTATGAGGG + Intergenic
1003113914 6:3270693-3270715 GTGCTGAGCAGTGTCTTCGTTGG + Exonic
1004205728 6:13589974-13589996 GTGAAGAGCAGGGTCGGTGTGGG + Intronic
1006296567 6:33172554-33172576 CTGGAGAGCAGGGACTACCTGGG - Exonic
1007235997 6:40391938-40391960 ATGGAGAGCACGGTCTAGGTGGG - Exonic
1007692149 6:43709419-43709441 GTGCAGACCAGGGTCAAGGGAGG - Intergenic
1023831254 7:44040102-44040124 GTGAAGTGCAGTGCCTACGTGGG + Intergenic
1029741584 7:102494408-102494430 GTGAAGTGCAGTGCCTACGTGGG + Intronic
1029759575 7:102593577-102593599 GTGAAGTGCAGTGCCTACGTGGG + Intronic
1029776942 7:102689487-102689509 GTGAAGTGCAGTGCCTACGTGGG + Intergenic
1034618971 7:152442499-152442521 GTGCAGAGTGGGGTCTGCGTCGG - Intergenic
1035667520 8:1389816-1389838 GGGCAGATCTGGGTCTGCGTTGG - Intergenic
1042007269 8:64194797-64194819 GTGGAGAGCAGGCTCTACGCAGG - Intergenic
1043542611 8:81280552-81280574 GTGCAGAGAGGGGTCTGCGTCGG - Exonic
1045511208 8:102813255-102813277 GTGCAGAGCAGGGTGGATGGTGG + Intergenic
1048987788 8:139744521-139744543 GTGCAGAGCTGGGCCTGCCTCGG - Intronic
1057353248 9:94317342-94317364 GGGCAGAGCAGGGGCTGCCTGGG - Intergenic
1057654503 9:96940250-96940272 GGGCAGAGCAGGGGCTGCCTGGG + Intronic
1200211671 X:154349400-154349422 GGGCTGAGCAAGGCCTACGTAGG - Exonic