ID: 1108599899

View in Genome Browser
Species Human (GRCh38)
Location 13:51983410-51983432
Sequence TCATCTATAAGCCCCTGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1970
Summary {0: 10, 1: 509, 2: 664, 3: 481, 4: 306}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108599899_1108599910 17 Left 1108599899 13:51983410-51983432 CCCAGTCAGGGGCTTATAGATGA 0: 10
1: 509
2: 664
3: 481
4: 306
Right 1108599910 13:51983450-51983472 AGATCACCTGGGGCAAATGGTGG 0: 1
1: 0
2: 3
3: 61
4: 633
1108599899_1108599901 -9 Left 1108599899 13:51983410-51983432 CCCAGTCAGGGGCTTATAGATGA 0: 10
1: 509
2: 664
3: 481
4: 306
Right 1108599901 13:51983424-51983446 TATAGATGAAGCCATCTCCCTGG 0: 1
1: 0
2: 1
3: 18
4: 258
1108599899_1108599904 5 Left 1108599899 13:51983410-51983432 CCCAGTCAGGGGCTTATAGATGA 0: 10
1: 509
2: 664
3: 481
4: 306
Right 1108599904 13:51983438-51983460 TCTCCCTGGGACAGATCACCTGG 0: 8
1: 619
2: 690
3: 414
4: 383
1108599899_1108599905 6 Left 1108599899 13:51983410-51983432 CCCAGTCAGGGGCTTATAGATGA 0: 10
1: 509
2: 664
3: 481
4: 306
Right 1108599905 13:51983439-51983461 CTCCCTGGGACAGATCACCTGGG 0: 8
1: 688
2: 694
3: 463
4: 473
1108599899_1108599913 24 Left 1108599899 13:51983410-51983432 CCCAGTCAGGGGCTTATAGATGA 0: 10
1: 509
2: 664
3: 481
4: 306
Right 1108599913 13:51983457-51983479 CTGGGGCAAATGGTGGCTGTGGG 0: 1
1: 1
2: 24
3: 245
4: 686
1108599899_1108599906 7 Left 1108599899 13:51983410-51983432 CCCAGTCAGGGGCTTATAGATGA 0: 10
1: 509
2: 664
3: 481
4: 306
Right 1108599906 13:51983440-51983462 TCCCTGGGACAGATCACCTGGGG 0: 7
1: 683
2: 693
3: 463
4: 556
1108599899_1108599912 23 Left 1108599899 13:51983410-51983432 CCCAGTCAGGGGCTTATAGATGA 0: 10
1: 509
2: 664
3: 481
4: 306
Right 1108599912 13:51983456-51983478 CCTGGGGCAAATGGTGGCTGTGG 0: 1
1: 1
2: 24
3: 259
4: 753
1108599899_1108599909 14 Left 1108599899 13:51983410-51983432 CCCAGTCAGGGGCTTATAGATGA 0: 10
1: 509
2: 664
3: 481
4: 306
Right 1108599909 13:51983447-51983469 GACAGATCACCTGGGGCAAATGG 0: 1
1: 3
2: 63
3: 731
4: 914
1108599899_1108599902 -8 Left 1108599899 13:51983410-51983432 CCCAGTCAGGGGCTTATAGATGA 0: 10
1: 509
2: 664
3: 481
4: 306
Right 1108599902 13:51983425-51983447 ATAGATGAAGCCATCTCCCTGGG 0: 1
1: 0
2: 0
3: 8
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108599899 Original CRISPR TCATCTATAAGCCCCTGACT GGG (reversed) Intronic