ID: 1108605297

View in Genome Browser
Species Human (GRCh38)
Location 13:52031187-52031209
Sequence GCAATGTGCTGAGCCAGTTT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 1, 2: 1, 3: 17, 4: 207}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108605297_1108605299 14 Left 1108605297 13:52031187-52031209 CCAAAACTGGCTCAGCACATTGC 0: 1
1: 1
2: 1
3: 17
4: 207
Right 1108605299 13:52031224-52031246 CATTTTTTAAAAAAAGAAAATGG 0: 3
1: 9
2: 125
3: 839
4: 5135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108605297 Original CRISPR GCAATGTGCTGAGCCAGTTT TGG (reversed) Exonic
901347618 1:8560319-8560341 GCAATGTTTAGAGACAGTTTTGG - Intronic
902576733 1:17382690-17382712 GCCAAGTCCTGAGCCAGTTCAGG - Intronic
902608970 1:17586014-17586036 GCAATGTGTGGAGACATTTTTGG + Intronic
903512210 1:23884754-23884776 GCATTGTGCTGAGCCACTAAAGG - Intronic
903762102 1:25706070-25706092 GCAAACTGCAGAGCCAGTATTGG + Intronic
904229108 1:29052303-29052325 GCAATGTCCGGAGACATTTTTGG - Intronic
908350991 1:63286323-63286345 GCATGGTGCTGGGCCAGTCTGGG - Intergenic
908449709 1:64240229-64240251 TCAAGGTCCTGATCCAGTTTGGG + Intronic
911047496 1:93640359-93640381 GGAATGTGTTGAGCCAATGTAGG - Intronic
911452786 1:98086159-98086181 CCAAAGTACTGAGCCACTTTTGG - Intergenic
916290771 1:163164051-163164073 GAAATGTGCAGAGCCCGCTTGGG + Intronic
918072516 1:181143307-181143329 GCAATGTGATGAGCAAGTTGGGG - Intergenic
920736181 1:208534768-208534790 GCCAGGAGCTCAGCCAGTTTTGG + Intergenic
921708513 1:218350335-218350357 GCAATGTCCAGAGACACTTTGGG + Intronic
922756102 1:228097738-228097760 GGAATGTGAGGAGCCAGTGTGGG + Intronic
922926629 1:229352477-229352499 GCAATGTCCAGAGACATTTTTGG + Intergenic
924553265 1:245098002-245098024 GAATGGTGCTGAGCCAGTTAGGG + Intronic
1064759771 10:18606041-18606063 GCACTGTGCTGAACCCTTTTAGG - Intronic
1066156013 10:32678747-32678769 GCACTGTGCTGTGACAGCTTGGG + Intronic
1067076112 10:43183879-43183901 GGAATGTGCTGGGCCACTGTTGG + Exonic
1070718801 10:78742210-78742232 GCACTGTGCTGAGCCCTTTCTGG + Intergenic
1078468948 11:11571605-11571627 GCAATGGGCTGAGCTGGCTTTGG + Intronic
1078937242 11:15962909-15962931 GCAATGTGCTGTGTCTGTGTGGG + Intergenic
1079223876 11:18588584-18588606 GCAGTCCGCTGGGCCAGTTTGGG - Intronic
1080430050 11:32189672-32189694 GCAATGTCTGGAGCCATTTTTGG + Intergenic
1080800537 11:35605910-35605932 GCAGAGAGCTTAGCCAGTTTAGG - Intergenic
1081310725 11:41568627-41568649 GCTCTGTGCTGAGCCAGGGTGGG + Intergenic
1082300592 11:50499959-50499981 GCAATCTGTGAAGCCAGTTTGGG - Intergenic
1082828679 11:57599268-57599290 GCAATGTCCAGAGACATTTTTGG - Intronic
1083488433 11:62997853-62997875 GCTATGTGCACAGCCCGTTTTGG - Intronic
1085288048 11:75376990-75377012 GCAATGTGTGGAGACACTTTTGG + Intergenic
1085605439 11:77893548-77893570 GCAGTGAGCTGTGCCAGTCTGGG + Intronic
1085764375 11:79270202-79270224 GAAGTGTGTGGAGCCAGTTTGGG + Intronic
1086382708 11:86274531-86274553 GCATTGTGTTGTGCCAGATTGGG + Intronic
1089310967 11:117557873-117557895 GCAATGTGTGGAGGCATTTTTGG + Intronic
1091551579 12:1539131-1539153 GCAATGTCCAGAGACATTTTTGG - Intronic
1094265837 12:28558658-28558680 GCAATCTGCTGAGCCAGAAGAGG - Intronic
1094522013 12:31201513-31201535 AGAATGTGCTGTGTCAGTTTGGG - Intergenic
1095734321 12:45539963-45539985 GCAATGTCCGGAGACATTTTGGG - Intergenic
1095883138 12:47160565-47160587 CCAAAGTGCTGAGCCACTTTGGG + Intronic
1096667053 12:53172883-53172905 GGAAAGTTCTGAGCCAGATTTGG + Intronic
1100477520 12:94948326-94948348 GCAATGTCTGGAGCCATTTTTGG - Intronic
1102303532 12:111788300-111788322 GCAATGTCCAGAGACATTTTTGG + Intronic
1103141479 12:118552528-118552550 GCAATGTGTGGAGACATTTTTGG - Intergenic
1104493146 12:129212029-129212051 CCTTTGTGATGAGCCAGTTTCGG - Intronic
1106827547 13:33540855-33540877 TCAATATGCAGAGCCAATTTAGG + Intergenic
1107369329 13:39726178-39726200 GGAATGTGCAGAGTTAGTTTTGG - Intronic
1108268016 13:48731717-48731739 GCAATCTGCTGACCTACTTTGGG + Intergenic
1108433797 13:50381531-50381553 GCAGTGTCCTGAGCCAGAATAGG + Intronic
1108524362 13:51273216-51273238 GCAATGTCCTGAGGCATTTTTGG + Intronic
1108605297 13:52031187-52031209 GCAATGTGCTGAGCCAGTTTTGG - Exonic
1117301099 14:54429258-54429280 GCAATGTCCAGAGACATTTTTGG + Intronic
1119723777 14:76909398-76909420 GCTGTGTGCTGAGCCACTCTAGG + Intergenic
1120072846 14:80123007-80123029 GCAGTGTGCTGAGGCTGTGTAGG - Intergenic
1120757524 14:88257997-88258019 GCAATGTCCGGAGACATTTTTGG - Intronic
1121634772 14:95446475-95446497 GCAATGTGGTGGGCCAGTGGTGG - Intronic
1122404500 14:101492050-101492072 GCAATGTGTTGAGCCAGGCGTGG - Intergenic
1124021755 15:25931715-25931737 GCAATGTATGGAGACAGTTTTGG + Intergenic
1125158210 15:36613805-36613827 GCAATGTGCTTAGCTTCTTTGGG - Intronic
1127329239 15:57922650-57922672 GCAATGGGCTGAGCTGGCTTTGG + Intergenic
1128636384 15:69305221-69305243 GCAATGTCTGGAGACAGTTTTGG - Intronic
1128795094 15:70460744-70460766 GCAATGTCTAGAGACAGTTTTGG - Intergenic
1129583610 15:76838756-76838778 GGAATGTGTTGAGAGAGTTTGGG - Intronic
1129876682 15:78979913-78979935 GCAATGTCTGGAGACAGTTTTGG + Intronic
1131385452 15:92002850-92002872 GCACTGTGCTGACTCAGTATAGG + Intronic
1132728440 16:1348868-1348890 GCAATGTGCAGACGCATTTTTGG + Exonic
1133616138 16:7478742-7478764 GCAATAAGCGGAGTCAGTTTTGG - Intronic
1133908912 16:10047058-10047080 GCAATGTGTGGAGACAGCTTTGG - Intronic
1134419199 16:14070816-14070838 GGAATTGGCTGAGCCAGTGTTGG - Intergenic
1134673632 16:16074227-16074249 GCAATGTCTGGAGCCATTTTTGG - Intronic
1135911805 16:26568001-26568023 GCAATGTGTAGAGACATTTTTGG + Intergenic
1138679150 16:58672462-58672484 GGAATGTGCTGGGCAAGTTCAGG - Intronic
1145102907 17:20091544-20091566 GCAATGTGCAGAGGCATTTACGG - Intronic
1148173065 17:45539633-45539655 GTAATGTCCGGAGACAGTTTTGG - Intergenic
1148276203 17:46305817-46305839 GTAATGTCCGGAGACAGTTTTGG + Intronic
1148298320 17:46523392-46523414 GTAATGTCCGGAGACAGTTTTGG + Intronic
1148362861 17:47027865-47027887 GTAATGTCCGGAGACAGTTTTGG + Intronic
1150404271 17:64886556-64886578 GTAATGTCCGGAGACAGTTTTGG - Intronic
1153675677 18:7454202-7454224 GCAATGTCCGGAGATAGTTTTGG - Intergenic
1154128134 18:11712306-11712328 GCACTGTGCTGTGCCAGCTTGGG + Intronic
1156508258 18:37612897-37612919 GCATTGTGCTGAGCCAGGCTGGG - Intergenic
1156662332 18:39360136-39360158 TCAATGAGCTGAGGCTGTTTGGG - Intergenic
1156738558 18:40295212-40295234 GCAATGTGCTTATGTAGTTTTGG + Intergenic
1158011223 18:52730198-52730220 GCAATGTCCAGAGACATTTTTGG + Intronic
1162822475 19:13231393-13231415 GCAATGTCCGGAGACATTTTTGG + Intronic
1162846996 19:13400665-13400687 GCAATGTGTGGAGACATTTTTGG + Intronic
1163417894 19:17197653-17197675 GCAATGTCTAGAGACAGTTTTGG - Intronic
1165594889 19:37004525-37004547 GCAATGTCCAGAGTCATTTTTGG + Intergenic
1168343431 19:55639159-55639181 GCAATGTGTAGAGACATTTTGGG + Intronic
1168529573 19:57117126-57117148 GCAATGTCTGGAGACAGTTTTGG - Intergenic
925342949 2:3149425-3149447 GCATTGTCCTGAGCCAGGTGGGG + Intergenic
929813412 2:45211558-45211580 GCAATGCTCTGTACCAGTTTAGG + Intergenic
931730467 2:65148637-65148659 GCAATGTCTGGAGACAGTTTTGG - Intergenic
933294969 2:80479287-80479309 GCAACGTTCTGAGACATTTTTGG + Intronic
933594491 2:84269163-84269185 GCAATATCCTGAGCCATTTTTGG + Intergenic
935968801 2:108510170-108510192 GCACTGTGCTGGGCCAAATTTGG - Intergenic
936149167 2:110002572-110002594 GGAGTGTTCTGAGCCATTTTTGG - Intergenic
936195514 2:110368797-110368819 GGAGTGTTCTGAGCCATTTTTGG + Intergenic
936508186 2:113124736-113124758 ACAATGTGCAGAGCCTGTCTTGG - Intronic
936924709 2:117724604-117724626 GCAATGTCTGGAGACAGTTTTGG - Intergenic
937088758 2:119190785-119190807 GCAGTCTGCTGAGCCAGAGTAGG + Intergenic
937232789 2:120409028-120409050 CCAAAGTGCTGAGCCACTTGGGG - Intergenic
937348592 2:121144019-121144041 GCAATGTCTGGAGACAGTTTTGG - Intergenic
937363417 2:121244452-121244474 GCATTCTGAGGAGCCAGTTTTGG + Intronic
937453314 2:122020344-122020366 GATGTGTGCTGAGGCAGTTTTGG - Intergenic
939688526 2:145228707-145228729 GCAATGTGATGAGGCAGCATCGG + Intergenic
942721682 2:178960011-178960033 GCAATGTCTAGAGACAGTTTTGG + Intronic
945103794 2:206289190-206289212 GCAATGTGCTGCTTCAGTTCAGG + Intronic
945707335 2:213251752-213251774 ACAATGTGCTGAGTCAGAGTGGG + Intergenic
946119247 2:217494879-217494901 GCACAGTGCTCAGCCCGTTTTGG - Intronic
1170653043 20:18260306-18260328 GCAATGAGCTGAGAAAGTTTGGG - Intergenic
1172488415 20:35314510-35314532 TGAATGTGCTGAGCATGTTTGGG - Intronic
1172707986 20:36896905-36896927 GGAATGAGCTGAGACTGTTTAGG - Intronic
1173114320 20:40225586-40225608 GCCATGTGTGGAGACAGTTTTGG + Intergenic
1173267515 20:41498482-41498504 TCATTGTCCTGGGCCAGTTTGGG - Intronic
1174036152 20:47669484-47669506 GCAATGTTTGGAGACAGTTTTGG - Intronic
1174746827 20:53071940-53071962 GCAATTTGCAGAGTCATTTTTGG + Intronic
1177622694 21:23617263-23617285 GCAGGCTGATGAGCCAGTTTAGG - Intergenic
1179779526 21:43690453-43690475 GAAATGTGCTGTGCCACTCTGGG - Intronic
1180583582 22:16865627-16865649 GGAGTGTTCTGAGCCATTTTTGG + Intergenic
1181643385 22:24216676-24216698 GCACTGTCTTGAGACAGTTTTGG + Intergenic
1182930906 22:34173552-34173574 GCATTTTGCTGCTCCAGTTTTGG - Intergenic
1183355158 22:37354857-37354879 GCAATGTCTGGAGGCAGTTTTGG - Intergenic
1184385771 22:44173765-44173787 GCAATGTCTGGAGACAGTTTGGG + Intronic
949818999 3:8094591-8094613 TCAATATGCTTTGCCAGTTTTGG - Intergenic
949894784 3:8760976-8760998 GCAATGTCTGGAGACAGTTTTGG + Intronic
949908490 3:8879649-8879671 GCAATGTGTGGAGACACTTTTGG - Exonic
950205790 3:11079504-11079526 GTAATGCCCTGAGCCACTTTGGG + Intergenic
950271556 3:11620189-11620211 GCAAGTTGCTGAGCCACTTTTGG - Intronic
950931773 3:16797078-16797100 GCAATGTGCTGAGCCACAGGTGG - Intergenic
954293114 3:49660188-49660210 GCCATGTGCTGGGCCAGTACAGG + Intronic
954364670 3:50139562-50139584 CAGATCTGCTGAGCCAGTTTGGG - Intergenic
955986956 3:64583623-64583645 GCAATGTCTGGAGACAGTTTTGG - Intronic
956204640 3:66742510-66742532 GCAATGTCCAGAGACATTTTGGG - Intergenic
956504910 3:69927693-69927715 GCAATGTTTGGAGCCAGTTTTGG + Intronic
956700456 3:71954478-71954500 GAAATGTGCTGAGTCTGTTTGGG - Intergenic
959726738 3:109551796-109551818 GCAATCTGCAGTGCCTGTTTGGG + Intergenic
962565363 3:136652913-136652935 GCAATGTGTGGAGACATTTTTGG - Intronic
962753358 3:138450766-138450788 GCCAGGTCCTGAGCCAGCTTTGG - Intronic
963123505 3:141795255-141795277 GCAATGTCTGGAGACAGTTTTGG + Intronic
963390042 3:144649761-144649783 GCAATGTACTTGGCCAGTTTAGG - Intergenic
963859824 3:150297721-150297743 AGAATGTGATGAGCCAGATTTGG + Intergenic
968966932 4:3773502-3773524 GGATTGTGCTGGGCCAGTGTAGG - Intergenic
969201569 4:5610617-5610639 GCAATGCCCTGAGCCTGTCTTGG - Intronic
975306970 4:72860993-72861015 GGAATGTGTAGAGTCAGTTTTGG + Intergenic
976197620 4:82548553-82548575 GCAATTTGGGGAGCCACTTTTGG - Intronic
976914417 4:90352962-90352984 GCAATATGCAGAGCTATTTTAGG + Intronic
977242007 4:94584046-94584068 CCAGTGTGCTGAGACAGTTTTGG + Intronic
977836370 4:101650021-101650043 GCAATGTACTGAGCCAGGTGAGG - Intronic
979322947 4:119345564-119345586 GGAATGTGCTGGGCTACTTTAGG + Intergenic
980890034 4:138804909-138804931 GGAATGTGCTGAGCCGGTTCAGG + Intergenic
981516558 4:145616459-145616481 GCAATGTCCAGAGACATTTTTGG - Intergenic
986262722 5:6162504-6162526 GCAATGTACTGAGCTATTTATGG + Intergenic
986406922 5:7435296-7435318 GCATTGTGCTTAGCCATTTGTGG + Intronic
987371927 5:17201465-17201487 CAAAAGTGCTGAGCCACTTTGGG + Intronic
987592560 5:19949715-19949737 GCAATGTATTTGGCCAGTTTTGG + Intronic
988018258 5:25589470-25589492 GCAATGTCCTTTGCAAGTTTAGG - Intergenic
988510470 5:31860348-31860370 GCAGTGTGGAAAGCCAGTTTGGG - Intronic
988726395 5:33930521-33930543 GCAATGTTTGGAGACAGTTTTGG + Intergenic
988797587 5:34666403-34666425 GCAAAGTGAAGAGCCAGTTGGGG - Intronic
989740453 5:44764877-44764899 ATCATGTGCTGAGCCAGATTTGG + Intergenic
991945597 5:71895749-71895771 GCTGTGAGCTGAGCCAATTTGGG - Intergenic
995164775 5:109026540-109026562 TAAATGTGCTGAGCCAGCTAGGG + Intronic
995530598 5:113088307-113088329 CCAATATGCTGAGTCAGCTTAGG + Intronic
995614344 5:113944241-113944263 GCAATGAGCTGTGCCAGGTTGGG - Intergenic
996204634 5:120716982-120717004 GCAATGTGCTGGTACAGGTTAGG + Intergenic
996284283 5:121770257-121770279 GCAATGTGGAGAGGAAGTTTAGG + Intergenic
996758700 5:126964812-126964834 ACAACATGGTGAGCCAGTTTTGG + Intronic
997142287 5:131395361-131395383 GCAATGTCAGGAGACAGTTTTGG + Intronic
998697420 5:144656035-144656057 GCAATGTCCTGAAGCTGTTTTGG + Intergenic
998855457 5:146390674-146390696 GCAATGTCTGGAGACAGTTTTGG - Intergenic
999821448 5:155233002-155233024 GCAATGTCTGGAGACAGTTTTGG + Intergenic
999886305 5:155926923-155926945 GCAATGTCCAGAGACACTTTTGG + Intronic
1000599867 5:163259662-163259684 GCAATGTCTTGAGACAGTTTTGG + Intergenic
1005915485 6:30347026-30347048 TCAATGTCCTGAGCCACCTTAGG + Intergenic
1006218002 6:32462274-32462296 GCAATGTCTGGAGCCATTTTTGG - Intergenic
1009272821 6:61636573-61636595 GCAATGTCTGGAGACAGTTTTGG + Intergenic
1009974168 6:70655348-70655370 GCAAAGTTCTGAGAAAGTTTTGG + Intergenic
1011746509 6:90412474-90412496 GCAATGAGCAGAACCACTTTTGG + Intergenic
1015535146 6:134259890-134259912 GCAAAGTGCTAACCCAGTTATGG + Intronic
1017942724 6:159067398-159067420 GGAATGTGATGGGCCAGGTTAGG + Intergenic
1021451996 7:20791233-20791255 GCAGCGAGCTGAGCCAGGTTGGG + Intergenic
1022386269 7:29901965-29901987 GCAATGTCTGGAGCCATTTTTGG + Intronic
1023507161 7:40911721-40911743 GCAATGTGTGGAGACATTTTTGG - Intergenic
1024475840 7:49809313-49809335 GAAATGAACTGAGTCAGTTTTGG - Intronic
1025847165 7:65210542-65210564 GCAGTGAGCTGTGCCAGTCTGGG - Intergenic
1025897409 7:65716429-65716451 GCAGTGAGCTGTGCCAGTCTGGG - Intergenic
1031026369 7:116684655-116684677 GCCATGTGCTCAGCCACTCTGGG - Intronic
1034511455 7:151538440-151538462 GCACTGTGCAGAGCCAGGCTTGG + Intergenic
1035024580 7:155817482-155817504 GGAGTGGGCTGAGCCAGCTTTGG - Intergenic
1037138926 8:15496572-15496594 GAAATGTGCTGAGCCTGGTAAGG - Intronic
1039106905 8:33999898-33999920 GCAGTGTCCGGAGACAGTTTTGG + Intergenic
1044952062 8:97444615-97444637 GCAATGTGCTCAGGGTGTTTTGG - Intergenic
1046750092 8:117917943-117917965 ACAGTGTGCTGACCAAGTTTTGG - Intronic
1047447311 8:124930867-124930889 GCAATGTGTGGAGACATTTTGGG - Intergenic
1047449539 8:124952558-124952580 GCAATGTGTGGAGACATTTTTGG - Intergenic
1047660987 8:127036393-127036415 GCAAGGTGCTGAGCTAGAATGGG - Intergenic
1048299637 8:133241944-133241966 GCTCTGTCCTGAGCCAGGTTTGG - Intronic
1049750195 8:144279407-144279429 GCCATGTGCTCAGCCACCTTAGG + Intronic
1050433900 9:5589215-5589237 GGAATGTGCCCAGCCAATTTGGG - Intergenic
1050468551 9:5960071-5960093 TCAATGTGCTGTGCTAGTCTGGG - Intronic
1051592018 9:18785852-18785874 CCAATGTGCAGTGCCAATTTTGG - Intronic
1052085006 9:24254207-24254229 GCACTGAGATAAGCCAGTTTAGG + Intergenic
1054962623 9:70985681-70985703 GCACTGTGCTGGGCCCTTTTGGG + Intronic
1055036133 9:71820513-71820535 GCAAGGTGCTGAGCCAGGAAAGG + Intergenic
1055140770 9:72874702-72874724 GCAATGTCCAGAGACATTTTTGG + Intergenic
1057149798 9:92786193-92786215 GCAATGTCCAGAGTCATTTTTGG - Intergenic
1059543698 9:115155368-115155390 GATATGTGCTGAGCCAGTGCTGG - Intronic
1059863901 9:118491962-118491984 GCAACAGGCTGAGCCAATTTTGG + Intergenic
1060789061 9:126473550-126473572 GCCATGTGATGAGCCTGTTCTGG - Intronic
1185831524 X:3307719-3307741 GCAATGTCCAGAGACATTTTTGG + Intergenic
1185925383 X:4139987-4140009 GCAAGGTGTGGAGACAGTTTTGG - Intergenic
1186430556 X:9500860-9500882 GCAATGTCTGGAGACAGTTTTGG + Intronic
1186560488 X:10607323-10607345 GCAATGTGCTGAGACATTTTTGG + Intronic
1186958977 X:14714264-14714286 GCAATGTCTTGAGACATTTTTGG + Intronic
1187285869 X:17903144-17903166 GCAATGTCTGGAGGCAGTTTTGG - Intergenic
1187604148 X:20864845-20864867 GCAATGTCTAGAGACAGTTTTGG - Intergenic
1189285087 X:39846449-39846471 GCAATGTCTGGAGACAGTTTTGG - Intergenic
1192738790 X:73874120-73874142 GCACTGTGCTTAGCCAGGATGGG + Intergenic
1192840374 X:74849295-74849317 GCACTCTGCTCAGCCAGATTGGG + Intronic
1193489464 X:82131837-82131859 GCCATGTGCTGTGCAAATTTGGG - Intergenic
1194405131 X:93487670-93487692 CCACTGTGCTGGGCCAATTTAGG - Intergenic
1195564817 X:106328157-106328179 GGAATGTGCTGGGCCACTGTTGG + Intergenic
1195678062 X:107522554-107522576 CCAATGTGCTTAGCCACTGTGGG + Intronic
1195720415 X:107861931-107861953 GCAGTGTGCTGTGACAGCTTTGG + Intronic
1197745438 X:129929685-129929707 GCAATGTACTGAGCCAGTTTTGG - Exonic
1199879568 X:151962533-151962555 GCAATGTGGTGAGCCAGCTATGG - Exonic