ID: 1108605978

View in Genome Browser
Species Human (GRCh38)
Location 13:52039018-52039040
Sequence TGGAATAACCAATAGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 105}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108605978 Original CRISPR TGGAATAACCAATAGGAGCC AGG Intronic
901396567 1:8986392-8986414 TGGAAAGGCAAATAGGAGCCAGG + Intergenic
909584940 1:77279534-77279556 AAGAATAACCATTAGGGGCCGGG - Intergenic
912650308 1:111432844-111432866 TGGGATAACTGAGAGGAGCCAGG - Intergenic
915313519 1:155016150-155016172 TGGGATGACCAGGAGGAGCCAGG + Intronic
916089037 1:161292613-161292635 TGTTATAACCAGAAGGAGCCTGG + Intergenic
918276676 1:182959564-182959586 TGGAAGAACCAAGAAGAGCTGGG - Intergenic
924578386 1:245301259-245301281 TGTAATAACCCAGAGCAGCCTGG - Intronic
1067377019 10:45736701-45736723 TGGAATACCCAATTTAAGCCTGG - Intronic
1067493857 10:46743635-46743657 TTGAATAAGTAATAGAAGCCTGG - Intergenic
1067884723 10:50077395-50077417 TGGAATACCCAATTTAAGCCTGG - Intronic
1071652341 10:87404636-87404658 TTGAATAAGTAATAGAAGCCTGG + Intergenic
1073436052 10:103516774-103516796 TGGAATAACCAGTACGATTCTGG + Intronic
1079645013 11:22852248-22852270 TGGAATAACCAAGGGCAGCTGGG - Intronic
1079710009 11:23670499-23670521 GGTCATTACCAATAGGAGCCAGG - Intergenic
1080202462 11:29688747-29688769 AGGAACAATCAATAGCAGCCAGG - Intergenic
1080230544 11:30014760-30014782 TGGAAAAATCAAGAGGAGACAGG - Intronic
1082902351 11:58268541-58268563 TAGAAAAACCAATAGTAGACAGG - Intergenic
1089189043 11:116641139-116641161 TGGAATAACTCACAGGAGGCTGG - Intergenic
1092622732 12:10290355-10290377 TAGAATGACCAATAGGAAGCTGG + Intergenic
1096276164 12:50210125-50210147 TTGAAAAACCAAAAGGGGCCGGG + Intronic
1101222862 12:102658716-102658738 TGGTATAAACAATATGATCCAGG - Intergenic
1103754741 12:123195657-123195679 TGGAATACCCACTAGGTGCTAGG + Intronic
1107585752 13:41846488-41846510 TTAAATAACCATTAGGTGCCAGG - Intronic
1108605978 13:52039018-52039040 TGGAATAACCAATAGGAGCCAGG + Intronic
1111318298 13:86589066-86589088 TGGAAGAGCCAATAAAAGCCTGG + Intergenic
1113148546 13:107236420-107236442 TGGGATAAAAAATAGGAGCATGG + Intronic
1114678754 14:24464880-24464902 GGTAATAACCCATATGAGCCAGG + Intergenic
1115698787 14:35927946-35927968 TGGTATCACCAACAGGATCCAGG - Intronic
1118124186 14:62881510-62881532 AGAAATAACCAATAGGTGCCTGG + Intronic
1127068326 15:55263278-55263300 TGAAATACCTAATAGGTGCCAGG + Intronic
1128897429 15:71388291-71388313 TGGAGTACCCACTAGGTGCCAGG + Intronic
1131847874 15:96507181-96507203 TGGAATTTCCAACAGGAGGCAGG + Intergenic
1135325494 16:21522915-21522937 TGGAAGCAACAGTAGGAGCCGGG + Intergenic
1135490773 16:22907416-22907438 GGGAAAAAACAATAGGAGCATGG + Intronic
1139197160 16:64932659-64932681 TGGAAAAACAAATATCAGCCGGG - Intergenic
1140919409 16:79523081-79523103 TGGAAAAACCATTAGATGCCAGG - Intergenic
1141047221 16:80726708-80726730 TGGAATATACAAAATGAGCCTGG + Intronic
1142038492 16:87877502-87877524 TGGAAGCAACAGTAGGAGCCGGG + Intergenic
1142320647 16:89380626-89380648 GACAATAACCAATAGGAGACAGG + Intronic
1143699229 17:8645732-8645754 TGGAAAAGCTAATATGAGCCAGG - Intergenic
1143724267 17:8834686-8834708 TGCAATGACCTATAAGAGCCTGG - Intronic
1144806701 17:17972491-17972513 TGTAACGACCAATAGGAGGCGGG - Intergenic
1146875739 17:36409110-36409132 TAAAATAACCAATGGGGGCCAGG - Intronic
1147063648 17:37903759-37903781 TAAAATAACCAATGGGGGCCAGG + Intergenic
1147473716 17:40689212-40689234 TGGAATAAGAAATTTGAGCCTGG - Intergenic
1149353773 17:55818328-55818350 TGGAATAGCCAGGAGGAGCTAGG - Intronic
1150173688 17:63026624-63026646 CTGAATATCCAATATGAGCCTGG - Intronic
1155833653 18:30550003-30550025 TAGAACAAACAATAAGAGCCAGG - Intergenic
1159688069 18:71448351-71448373 TTGAATAACTAATATAAGCCAGG - Intergenic
1164700709 19:30281934-30281956 TGGCATAACCAGAAGCAGCCTGG - Intronic
1166371479 19:42303670-42303692 TGGAATAACCACTGTGTGCCCGG - Intronic
927901451 2:26822198-26822220 TTGAAATAGCAATAGGAGCCGGG + Intergenic
931070110 2:58637418-58637440 TTGATTAACAAATATGAGCCAGG + Intergenic
933204474 2:79489656-79489678 TAGAATAAGCAAAATGAGCCAGG - Intronic
935077055 2:99755560-99755582 TTAAAAAACCAATAGGGGCCGGG - Intronic
936930956 2:117788249-117788271 TTGAGTAGCCAATTGGAGCCTGG - Intergenic
937314557 2:120922750-120922772 TGGAATCCCCAGGAGGAGCCTGG - Intronic
937598701 2:123703036-123703058 AGGAATAAACAAGATGAGCCTGG + Intergenic
939272165 2:139954020-139954042 TGGAATGGCCAAGGGGAGCCTGG + Intergenic
942036902 2:172018852-172018874 TGGAATACCGAATTGGATCCTGG - Intronic
943974196 2:194449885-194449907 GGGAATACCCAAGTGGAGCCTGG - Intergenic
945043956 2:205765622-205765644 TGGGATAAGCAAGAGGAGGCAGG + Intronic
946806718 2:223477850-223477872 TTGAATAACTATTAGAAGCCAGG + Intergenic
1173428643 20:42966074-42966096 TGGAATAGCCAAGAGGAGTTGGG + Intronic
1174515144 20:51086143-51086165 TGGAATGACCAACTGGTGCCTGG - Intergenic
1182190955 22:28460160-28460182 TTGAATAAGCAAAAGAAGCCAGG + Intronic
1182395418 22:30032414-30032436 TGGAACAATCAATCAGAGCCAGG + Intergenic
1183131296 22:35839359-35839381 TGGCATAACCAAAAAGAGGCAGG + Intronic
1183247802 22:36707364-36707386 TGGAGTAACTCCTAGGAGCCAGG + Intergenic
1185043469 22:48517494-48517516 TGGCATACCCTACAGGAGCCTGG - Intronic
949455333 3:4232191-4232213 TGTCAGACCCAATAGGAGCCTGG + Intronic
953655059 3:44844715-44844737 TGAAACAACCAATAAGAGTCTGG + Intronic
959514442 3:107249514-107249536 TGGAAGAACCCATAGGTGGCTGG - Intergenic
967472974 3:189884396-189884418 TAGAAAAAACAATAGGTGCCAGG + Intronic
969256821 4:6008001-6008023 TGCAGTGACCAATAGGGGCCTGG + Intergenic
969536082 4:7756795-7756817 TGAAATACCCAACATGAGCCTGG - Intergenic
980321466 4:131284452-131284474 TTGAATAATCAATAGTAGTCAGG + Intergenic
980652139 4:135731770-135731792 AGGAAAAAGCAAAAGGAGCCTGG - Intergenic
980759668 4:137214130-137214152 TGGAATATACAAGATGAGCCTGG + Intergenic
986377759 5:7149692-7149714 TGGAACAACCAAGAGGACACAGG - Intergenic
991098776 5:62768470-62768492 TGGAACTACCAATGGGAGTCTGG - Intergenic
992409496 5:76491696-76491718 CTGAACAACCAACAGGAGCCAGG - Intronic
994720223 5:103371917-103371939 TGGAAGGACTAAAAGGAGCCTGG + Intergenic
995689629 5:114809951-114809973 TGGAATAAACAATATGAGCAAGG + Intergenic
995992464 5:118258416-118258438 TGGAATATTCAAAATGAGCCTGG + Intergenic
1007729101 6:43935024-43935046 TGGAAGAACCAAGGGGAGTCAGG + Intergenic
1010976451 6:82320147-82320169 TGGAAAAGCCAAAAGGAGACTGG - Intergenic
1016387212 6:143540145-143540167 TGGAATCAAAAATAGGAGCAAGG - Intronic
1033851619 7:145503206-145503228 TGGAACAACCAATCACAGCCTGG - Intergenic
1034903888 7:154927218-154927240 TAGCAAAACCAATAGGAACCTGG + Intergenic
1035300044 7:157891223-157891245 GGGGATTACCAAGAGGAGCCTGG - Intronic
1039100091 8:33931593-33931615 TGGAATAAACAGTAGTTGCCAGG + Intergenic
1040677177 8:49764556-49764578 TGGAATCACAAAAAGGAGCCCGG + Intergenic
1042165594 8:65942745-65942767 TGGGATAACCAGAAGCAGCCTGG + Intergenic
1044809614 8:96045007-96045029 TGGAATCACCAATAATGGCCAGG - Intergenic
1045475978 8:102553064-102553086 TGGAAAAAGCAATAGGAGGCCGG + Intronic
1046827433 8:118706769-118706791 TGTATTCACCAATAGGAGACAGG + Intergenic
1047601694 8:126432139-126432161 TGGAATTTCAAATAGGGGCCGGG + Intergenic
1047936682 8:129787450-129787472 TGGAATACCCAATAGCAGGTTGG - Intergenic
1054883099 9:70165661-70165683 TGGAATATCCAAAAGGAGCCAGG + Intronic
1058785393 9:108381651-108381673 TGGAAAAGCCAGCAGGAGCCAGG + Intergenic
1059473090 9:114522106-114522128 TGGGAGCTCCAATAGGAGCCTGG - Intergenic
1059522488 9:114956728-114956750 TAGAATACCCACTTGGAGCCAGG - Intergenic
1059940636 9:119356085-119356107 TGGAATAACCAATAGGAAGTAGG - Intronic
1060643630 9:125259986-125260008 TGAAATAAGCAAGAGGAGGCCGG - Intergenic
1187260544 X:17681667-17681689 TGGAAAGACCAGTAGAAGCCTGG - Intronic
1194267760 X:91776730-91776752 CGGAATAACCAAAAGGCACCTGG - Intergenic
1195484959 X:105393627-105393649 AGGAATAACCAAAAGCAGCTTGG + Intronic
1196898756 X:120362706-120362728 TAGAATCCCCAATAGGAGCAGGG + Intronic
1196991887 X:121338739-121338761 TGGAAAAAAAAAAAGGAGCCAGG - Intergenic
1200584971 Y:4997655-4997677 CGGAATAACCAAAAGGCACCTGG - Intergenic
1201887878 Y:18906237-18906259 TGAAATATACAATAGGGGCCAGG + Intergenic