ID: 1108607021

View in Genome Browser
Species Human (GRCh38)
Location 13:52049869-52049891
Sequence TGTACCTCCTGATACCTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 4, 3: 10, 4: 115}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108607021_1108607025 -10 Left 1108607021 13:52049869-52049891 CCCACCAGGTATCAGGAGGTACA 0: 1
1: 0
2: 4
3: 10
4: 115
Right 1108607025 13:52049882-52049904 AGGAGGTACAATGGAAGCCATGG 0: 1
1: 0
2: 1
3: 35
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108607021 Original CRISPR TGTACCTCCTGATACCTGGT GGG (reversed) Intronic
900872307 1:5312773-5312795 TGCACCACCTGTTACCTGCTGGG + Intergenic
900872501 1:5314234-5314256 TGCACCGCCTGTTACCTGCTGGG - Intergenic
901746294 1:11375898-11375920 TGAACCTCCTGATCCGTGGAAGG + Intergenic
905596562 1:39212742-39212764 TGTAATTCCAGATACCTGGGAGG - Intronic
906046691 1:42836464-42836486 TGAGCCTCCTGAGGCCTGGTGGG + Intronic
906882811 1:49610975-49610997 AGTACTTCCTTATCCCTGGTTGG - Intronic
907554223 1:55330932-55330954 TGTACCCCCAGCTACCTGGGAGG + Intergenic
908444945 1:64191356-64191378 TGTTCATCCCCATACCTGGTTGG - Intergenic
909610555 1:77547393-77547415 TGTACTTCCAGCTACCTGGGAGG - Intronic
910059831 1:83077062-83077084 TCTACTTCCTGAGACTTGGTGGG - Intergenic
915573916 1:156762537-156762559 TGTACCTCTGGGTACCTGGTTGG + Intronic
915633855 1:157172989-157173011 TGCACCTTCTGCTGCCTGGTGGG - Intergenic
915637674 1:157197870-157197892 TGTGCCTCCTGCTACCTGGTGGG - Intergenic
916950386 1:169774328-169774350 TGTAGTTCCTGCTACCTGGGGGG - Intronic
918998079 1:191789008-191789030 TGTAACTGCTGCTACCTGGAGGG + Intergenic
919007409 1:191915505-191915527 TGCACCTCCTGAAACCTAGAGGG - Intergenic
921186864 1:212677986-212678008 TGTGCCTCCACATCCCTGGTCGG - Intergenic
923402687 1:233630014-233630036 TTCACCTCCTGATACCTGTGTGG + Intronic
923877524 1:238065338-238065360 TGGAACTCCTGACACTTGGTGGG + Intergenic
1069463817 10:68620070-68620092 TGTAACCCCAGATACCTGGGAGG + Intronic
1077416686 11:2427248-2427270 TGTACCTCCTCCTCCCAGGTGGG - Intergenic
1083645401 11:64169493-64169515 TGTAACTCCAGATACTTGGGAGG - Intergenic
1083698949 11:64461565-64461587 TATAAGTCTTGATACCTGGTAGG + Intergenic
1087938229 11:104060696-104060718 CGTACCTCCTGAAACAGGGTTGG - Intronic
1090176103 11:124651154-124651176 AGTAGTTCCTGATACATGGTAGG - Intronic
1101015803 12:100498801-100498823 TCTACCTCCTGACACTTGCTAGG - Intronic
1101459494 12:104875669-104875691 TGTAGTTCCTGATACTTGGGAGG + Intronic
1101806157 12:108065638-108065660 TGGAGCTCTTGATACCTCGTGGG + Intergenic
1102480091 12:113216965-113216987 TGTAATTCCAGCTACCTGGTAGG + Intronic
1102744928 12:115242228-115242250 TGTACCTCCTGAATTCTGGCTGG + Intergenic
1104999178 12:132678054-132678076 TGTAACCCCAGATACCTGGGAGG + Intronic
1108607021 13:52049869-52049891 TGTACCTCCTGATACCTGGTGGG - Intronic
1110379782 13:74837009-74837031 TGTAGCTCCAGCTACCTGGGAGG - Intergenic
1110401550 13:75097324-75097346 TGTACCACCTGATAACTGTGTGG + Intergenic
1111961726 13:94818501-94818523 TGTAAGTCCTGATATCTGGTAGG + Intergenic
1112272893 13:97986475-97986497 TGTAATTCCAGATACTTGGTAGG - Intronic
1117001482 14:51375519-51375541 CATATCTCCTGGTACCTGGTGGG + Intergenic
1119689351 14:76658949-76658971 TGTAGCTCCTGCTACTTGGGAGG - Intergenic
1122387939 14:101361705-101361727 TGTAAGTCCTGATACCTTGCTGG + Intergenic
1123773716 15:23556119-23556141 TGTAACTCCAGCTACCTGGGAGG - Intergenic
1125438270 15:39671972-39671994 TGTATCTGGTGAGACCTGGTGGG - Intronic
1126063058 15:44802521-44802543 TGTACCTTCTGCTTCCTGTTTGG - Intergenic
1129062043 15:72867870-72867892 TTTACCTCCTGATCTCTGGTAGG + Intergenic
1132031487 15:98441649-98441671 TGCATCTCCTGACACCTGGCAGG - Intronic
1135796175 16:25445005-25445027 TATCCCTCCTGAGACCTGGGAGG + Intergenic
1137921606 16:52494460-52494482 TTTACCTCATTATACATGGTGGG + Intronic
1138233114 16:55354446-55354468 AGTACCTCCTTATCCTTGGTGGG - Intergenic
1141113355 16:81288382-81288404 TGTAGCTCCAGCTACTTGGTGGG - Intronic
1141162006 16:81635486-81635508 TTTCCCTCCTAACACCTGGTGGG - Intronic
1142887834 17:2924270-2924292 TGCACCTCCCGATGCCTGGAGGG + Intronic
1143876144 17:9992147-9992169 GGTACCTCCTGATCCTTGGCTGG - Intronic
1143977257 17:10838970-10838992 TGTTCCTCAGGATAACTGGTGGG + Intergenic
1147572231 17:41578510-41578532 TGTAGCTCCTGATCACTGGAGGG - Intergenic
1148236187 17:45970781-45970803 TGTAACTCCTGCTTCCTGGTGGG + Intronic
1151869469 17:76826675-76826697 TGTACCTGCTGCTTCCTGGCCGG + Intergenic
1155441800 18:25870050-25870072 TTTCCCTCCTGGTCCCTGGTAGG + Intergenic
1155444557 18:25897435-25897457 TGGACCTCCTCACACTTGGTGGG - Intergenic
1156030199 18:32704400-32704422 TAGACCTTCTGATACCTTGTAGG - Intronic
1166149507 19:40861958-40861980 TGTAGCTCCAGCTACTTGGTAGG + Intronic
932961951 2:76422929-76422951 AGTACCTTCTGACACTTGGTGGG + Intergenic
933114610 2:78452477-78452499 TGTCCCTCTTGATCACTGGTAGG - Intergenic
936897295 2:117443190-117443212 TCTACCTTCTAATACATGGTAGG - Intergenic
939540622 2:143489935-143489957 TGTGCTTCCTGAAACCTGGGAGG + Intronic
943527550 2:189036678-189036700 TGTACCACGTAAAACCTGGTGGG - Exonic
943789435 2:191915793-191915815 TTTACCTCCAGATACTTGGGTGG + Intergenic
944497798 2:200326230-200326252 TGTAGCTCCAGCTACCTGGGAGG - Intronic
945135880 2:206627116-206627138 TTTCCCTCCTGATTCCTGGAAGG - Intergenic
1169229640 20:3879186-3879208 TGTACCTCCAGGTACTTGGGAGG + Intergenic
1172802627 20:37588235-37588257 TGTACCACTTTATACCTAGTAGG + Intergenic
1172921441 20:38486089-38486111 TGTAACTCCAGCTACCTGGGAGG - Intronic
1175969834 20:62679481-62679503 TGTACTTCCAGCTACCTGGGAGG - Intronic
1182049621 22:27302747-27302769 TGTACCTCCTAAAACCTGGTGGG + Intergenic
949926184 3:9043668-9043690 TTTACCTTCTGAGACCTGTTGGG + Intronic
951502185 3:23401188-23401210 TCTTTCTCCTGTTACCTGGTGGG - Intronic
961619229 3:128210396-128210418 TGTAACTCCAGATCTCTGGTGGG + Intronic
963187008 3:142429690-142429712 TTTACCTTCTGACACCAGGTAGG + Intronic
963961298 3:151312165-151312187 TGTTCCTCCTCAGACCTGCTAGG - Intronic
964989475 3:162789533-162789555 TGTAGTTCCAGATACTTGGTAGG + Intergenic
968229793 3:196998707-196998729 TGTACCTCCAGCTACTTGGGAGG - Intronic
969514330 4:7638158-7638180 TTCACCTCCTGATACCAGGGAGG - Intronic
971103293 4:23493896-23493918 TGTACCTCCTGAAACCCGCCAGG - Intergenic
972482342 4:39509094-39509116 TGTAGCTCCAGCTACCTGGGAGG - Intronic
972541756 4:40044950-40044972 TGTAGTCCCTGATACCTGGGAGG + Intergenic
972711837 4:41604943-41604965 TGTGCCTCCTTCTACTTGGTAGG - Intronic
973739676 4:53907623-53907645 TGTACGCCCTGATGCCTAGTTGG + Intronic
974649292 4:64733469-64733491 TGTACCTTTAGTTACCTGGTTGG + Intergenic
980881451 4:138713912-138713934 GGTAGCTACTGATATCTGGTAGG - Intergenic
981098634 4:140807100-140807122 TGGACCTCCTGTTTCCAGGTGGG - Intergenic
991063461 5:62401912-62401934 AGTAACTCCTGATCCCTTGTTGG - Intronic
999972300 5:156877138-156877160 AGAAAGTCCTGATACCTGGTAGG - Intergenic
1000152112 5:158513377-158513399 TGTTCCTCCTGTTACCTGGGAGG + Intergenic
1003443997 6:6168482-6168504 TGCACCCACTGCTACCTGGTTGG + Intronic
1009353348 6:62709034-62709056 AGTTCCTCCAGGTACCTGGTGGG + Intergenic
1009515397 6:64609763-64609785 TGTACTTCCAGCTACTTGGTAGG + Intronic
1011095263 6:83654852-83654874 TGTAGCTCCTGGTACCTCATAGG + Intronic
1012306663 6:97667308-97667330 TGCACAACCTGATGCCTGGTTGG + Intergenic
1019866703 7:3718383-3718405 TGTAGTTCCAGATACATGGTGGG + Intronic
1019932301 7:4231831-4231853 TGTACCTGGTGATTCCGGGTGGG + Intronic
1022411690 7:30143407-30143429 TGTATCTCGTGATACCTTGCCGG + Intronic
1028791545 7:94859196-94859218 TGTACATTCTGATTCATGGTAGG + Intergenic
1029667348 7:102004290-102004312 TGTACCTGATTATACCTGGCTGG - Intronic
1030476853 7:110045378-110045400 TGTAACTCCTGATATCTGGTTGG + Intergenic
1032240473 7:130155130-130155152 TGCACCTCCTGTTGCCTGCTTGG - Intergenic
1032755679 7:134888708-134888730 TATAGCTCATGCTACCTGGTAGG - Intronic
1035403144 7:158581223-158581245 TGTACCACAGGACACCTGGTGGG - Intronic
1037521723 8:19686384-19686406 TGTAGCTCCTGAGACCTGGTGGG - Intronic
1038069926 8:24002560-24002582 AGTACCACCTGATTCCTGGTAGG - Intergenic
1038127817 8:24693796-24693818 TGAACCTCCTGATATCTGGGTGG + Intergenic
1038162685 8:25055158-25055180 TGGACCTCCAGAAACCTGGATGG - Intergenic
1038636700 8:29293114-29293136 TGTAGCTCCAGCTACTTGGTAGG + Intergenic
1038815052 8:30894197-30894219 TGTACTTCCTGCTACGTGGCAGG + Intergenic
1040089220 8:43379265-43379287 TGTAACTCCAGATACTTGGGGGG + Intergenic
1040551990 8:48444921-48444943 TGTACCTCCTGCTCCCTGGAGGG + Intergenic
1040988779 8:53326699-53326721 TGTGCCTCTTGATATCTGTTGGG + Intergenic
1043527560 8:81112543-81112565 GATACCTACTGATACCTGGGTGG - Intergenic
1048375677 8:133820355-133820377 TGGATCTCCTGAAACCTAGTGGG + Intergenic
1048458751 8:134602204-134602226 TCTGCCTCCTGGAACCTGGTGGG - Exonic
1049509567 8:143020682-143020704 TCTCCCTCCTGAAACCTGGCAGG - Intronic
1054993347 9:71355655-71355677 TGTACTTCCTTTTACCTTGTTGG - Intronic
1061289811 9:129644233-129644255 TGTAATTCCAGCTACCTGGTAGG - Intergenic
1061513871 9:131077179-131077201 TGGACCTCCTGGTACCTGGGAGG - Exonic
1203444831 Un_GL000219v1:45200-45222 TCTACCTCCCGGTACCTGGACGG + Intergenic
1203560115 Un_KI270744v1:46260-46282 TGTAGTTCCAGGTACCTGGTAGG + Intergenic
1188223563 X:27570134-27570156 TGCACCTCCAGAAACTTGGTAGG + Intergenic
1192789474 X:74367196-74367218 TATATCTCCTGTTACCTGGTAGG - Intergenic
1194803183 X:98296238-98296260 TGTTCTTCCTGCTTCCTGGTTGG + Intergenic
1198069554 X:133134677-133134699 TGTACCTCCTGCCACCAGGAAGG + Intergenic
1198593128 X:138206613-138206635 TGTATTCCCTGATACCTTGTAGG - Intergenic
1200777702 Y:7184231-7184253 TGTAGCTCCAGATACATGGGGGG - Intergenic
1202108775 Y:21399755-21399777 TGTAGCTCCAGCTACTTGGTAGG - Intergenic