ID: 1108609641

View in Genome Browser
Species Human (GRCh38)
Location 13:52071533-52071555
Sequence CTGGCTGGGGCCAGTGTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 1, 2: 6, 3: 40, 4: 330}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108609641_1108609648 8 Left 1108609641 13:52071533-52071555 CCCACAACACTGGCCCCAGCCAG 0: 1
1: 1
2: 6
3: 40
4: 330
Right 1108609648 13:52071564-52071586 GTGACACTAACCAAAATAAAGGG 0: 1
1: 0
2: 0
3: 27
4: 300
1108609641_1108609649 15 Left 1108609641 13:52071533-52071555 CCCACAACACTGGCCCCAGCCAG 0: 1
1: 1
2: 6
3: 40
4: 330
Right 1108609649 13:52071571-52071593 TAACCAAAATAAAGGGTCACTGG 0: 1
1: 0
2: 1
3: 14
4: 220
1108609641_1108609650 16 Left 1108609641 13:52071533-52071555 CCCACAACACTGGCCCCAGCCAG 0: 1
1: 1
2: 6
3: 40
4: 330
Right 1108609650 13:52071572-52071594 AACCAAAATAAAGGGTCACTGGG 0: 1
1: 0
2: 1
3: 22
4: 223
1108609641_1108609647 7 Left 1108609641 13:52071533-52071555 CCCACAACACTGGCCCCAGCCAG 0: 1
1: 1
2: 6
3: 40
4: 330
Right 1108609647 13:52071563-52071585 TGTGACACTAACCAAAATAAAGG 0: 1
1: 0
2: 2
3: 10
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108609641 Original CRISPR CTGGCTGGGGCCAGTGTTGT GGG (reversed) Intronic
900530711 1:3151666-3151688 CTGGCAGAAGCCAGTGCTGTGGG - Intronic
900593839 1:3471576-3471598 CTGGCTGGGGGCAGAGCTGGGGG - Intronic
900803009 1:4749053-4749075 CATGCTGGGGACAGTGTTGCTGG - Intronic
900868885 1:5287906-5287928 CTGGATGGGGCCTGGGATGTGGG - Intergenic
901686538 1:10946634-10946656 GTGGCTGGGTACAGTGTTCTGGG - Exonic
902620568 1:17648435-17648457 CTGGATGGGGCCAGGCTTCTGGG + Intronic
902983042 1:20139241-20139263 CTGGCTGTGGGCAGGGCTGTGGG + Intergenic
903548417 1:24141441-24141463 CTGGTTGAGGTCAGTGTTCTGGG + Intronic
903646123 1:24897413-24897435 CGGGGTGGGGCCAGTGCCGTGGG - Intergenic
903664198 1:24996605-24996627 GTGGCTGTAGCCAGTGCTGTGGG - Intergenic
903972670 1:27129274-27129296 CTGGCTGGGCTCTGTGTGGTGGG + Intronic
904406638 1:30294823-30294845 TTAGCTGGGGCCAGTGTCATGGG - Intergenic
904659377 1:32073208-32073230 CGGGGTGGGGCCTCTGTTGTGGG + Intronic
905805976 1:40877899-40877921 CTGGCTGGGGCCTGTGGGATGGG + Intergenic
906148749 1:43575587-43575609 CTGGCTGGGGCCAATGGAGGGGG - Intronic
906680849 1:47724807-47724829 CTGGCTGGCTCCAGTGTTCCAGG + Intergenic
906708762 1:47913975-47913997 CAGGCTGGGGCCTGTGTCATTGG + Intronic
907920443 1:58906327-58906349 CTGCCTGGGGACAGAGCTGTGGG + Intergenic
907996876 1:59641995-59642017 GTGGCTGGGAACAGGGTTGTGGG - Intronic
908365800 1:63422606-63422628 TTTGGTGGGGCCAGTGTTGGTGG + Intronic
908997211 1:70169376-70169398 CTGACTGGGGCCAGCGTTCTGGG - Intronic
909301428 1:74017639-74017661 CTGGCTGGGGCCACTGTCTGTGG - Intergenic
909820505 1:80053727-80053749 CTGCCTGGGGCCAGTGGGGCTGG + Intergenic
910216307 1:84848123-84848145 CAGGCTGTGGCCAGGCTTGTTGG - Intronic
911042166 1:93599602-93599624 CTGGATGGGGCCAGGGCTGGAGG + Intronic
912432575 1:109636803-109636825 CTGGCTGGTGGCAGTGTGGGTGG + Intergenic
912675516 1:111676724-111676746 CTGTTTGGGGCCAGTGGTGGTGG - Intronic
915591682 1:156874490-156874512 CCAGCTGGGGCCAGGGTTGGGGG + Intronic
915872576 1:159576731-159576753 CTGCATGGGCCCAGAGTTGTAGG - Intergenic
916588684 1:166169203-166169225 CTAGCTTGGGGCAGTGCTGTGGG + Intergenic
917531028 1:175835085-175835107 CTGGCTGGGGCTGGCGTTGAGGG - Intergenic
917531216 1:175836822-175836844 CTGGCTGGGCCCAGCGTTGTGGG - Intergenic
917571037 1:176265747-176265769 CTGGCTGGGGCCAGCATTGCAGG + Intergenic
918002231 1:180508703-180508725 CTGCCCGGGGCCAGTGTTTCCGG - Intergenic
919660087 1:200235895-200235917 CTGGGTGGGCCCACTGTTCTAGG - Intergenic
919771832 1:201166253-201166275 CTAACTGGGGCCAGTGGTGTGGG - Intronic
919929513 1:202212272-202212294 CTGGCTTGGGCCAGTGATGGAGG + Intronic
920459772 1:206130560-206130582 CTGGCTGGGGGCAGTGGCTTAGG + Intergenic
920588738 1:207195849-207195871 CTGGCTGGGGCCAGCCTTGCAGG + Intergenic
921945706 1:220884630-220884652 CTGGCTGTGGGCTGTGTTGCAGG - Exonic
922112036 1:222569062-222569084 TTGTCTGGGGCCATGGTTGTGGG + Intronic
922267031 1:223993058-223993080 CTGGCTGGGGGAGGCGTTGTGGG - Intergenic
922561896 1:226575516-226575538 CTGGCTGGGCTCTGGGTTGTGGG + Intronic
923959179 1:239057379-239057401 CTGGCTGTGGCTGGTGTCGTGGG - Intergenic
1062877678 10:955323-955345 CTGCCTGGCGCCTGTGGTGTGGG - Intergenic
1062909618 10:1204341-1204363 ATGGATGGGGCCAGTCTTGAAGG + Intronic
1063340549 10:5259322-5259344 CTGGCTGGGGCCACTGTCAGTGG + Intergenic
1063448276 10:6133987-6134009 CTGGCCGAGGCCAGCTTTGTCGG + Intergenic
1065641883 10:27791383-27791405 CTGGCTGAGCCCAGTGTTAGTGG - Intergenic
1065941959 10:30573042-30573064 CTGGCTGGGGACAGTTTCATGGG - Intergenic
1066272574 10:33837806-33837828 ACGGCTGGGGCCAGTGCTTTGGG - Intergenic
1066371999 10:34825193-34825215 CTAGCTGTGGCCAGTGAGGTGGG - Intergenic
1066495323 10:35936824-35936846 CTGGCAGTAGGCAGTGTTGTGGG - Intergenic
1066726668 10:38402536-38402558 CTGGCTGGGGGAGGCGTTGTGGG + Intergenic
1067083370 10:43225835-43225857 CAGGTTGGGGCCAGAGTTGAAGG + Intronic
1067209702 10:44249841-44249863 CTTGCTGGGCCCAGTGGTGGTGG + Intergenic
1067282536 10:44883352-44883374 CTGAATGGGGGCAGTCTTGTGGG - Intergenic
1067320765 10:45218677-45218699 GTGGCTGGGCCCAGTGTGCTGGG - Intergenic
1069160027 10:65082363-65082385 CTGGCTTGGGACTGTGTTGAAGG + Intergenic
1069255313 10:66324572-66324594 GAGGCTGGGGCCAGTGCTTTGGG - Intronic
1069783838 10:70975381-70975403 CTTCCTGGGTCCAGTGTTGGAGG - Intergenic
1070525678 10:77293963-77293985 CCGGCTGGGGCCAGGGTGCTTGG - Intronic
1070644622 10:78193102-78193124 CTGGCTGGGGCTGGTGTGGCAGG - Intergenic
1071431383 10:85609653-85609675 CTGGCTGAGGCCAGGGTGGCCGG - Intronic
1071924637 10:90391937-90391959 ATGGCTGGGGCCAATTTTGCAGG - Intergenic
1073457482 10:103646396-103646418 CTGGTCTGGGCCAGTGTTGTGGG - Intronic
1073848507 10:107587401-107587423 CTGGCTGGGGCCACTGGAGCTGG - Intergenic
1074502892 10:114043170-114043192 CTGGCTGGGTCCCGTCTTGACGG + Intergenic
1076238102 10:128881472-128881494 CAGGCAGGGGCCAGTGCAGTTGG + Intergenic
1077060104 11:614173-614195 CTGACTGGGGCCTGTGCTGGAGG - Exonic
1077129555 11:963996-964018 CTGGCTGACGCCTCTGTTGTGGG - Intronic
1077520229 11:3028831-3028853 CTGGGTGGGCCCAGAGTTGTAGG + Intronic
1077522430 11:3044253-3044275 CTGGCTGTGGCCAGGCTTCTTGG - Intronic
1079083296 11:17428581-17428603 CTGGCTGGGCCCTGAGGTGTGGG + Exonic
1080306720 11:30844581-30844603 CTGGCTGGAGCCAGTGTGGCTGG + Intronic
1080696785 11:34609673-34609695 CTAGTTGGGGGCAGTGTTGGGGG + Intergenic
1080852207 11:36079544-36079566 CTGGTTGGGGCTGATGTTGTGGG + Intronic
1082051234 11:47772031-47772053 CTAATTGGGGCCAGTGTTGCAGG - Intergenic
1082283645 11:50298147-50298169 CTGGCTGGGGGAGGTGTTGTGGG + Intergenic
1084048269 11:66583510-66583532 CTGGCTGGAGCCAGTGTTGTGGG - Intergenic
1084416894 11:69037683-69037705 CTTGGTGGGGACAGTGATGTTGG - Intergenic
1084532328 11:69734944-69734966 TGTGCTGGAGCCAGTGTTGTTGG + Intergenic
1084609499 11:70193234-70193256 GTGGCTGGGGGCAGGGTTGGGGG + Intergenic
1084789592 11:71464987-71465009 CTAGCTGGGGCCAATGGTGCAGG + Intronic
1085472717 11:76768478-76768500 CTGGCTGGGGGCAGGGGGGTTGG - Intergenic
1088099680 11:106142100-106142122 CTAGCTGGGGCCAGTGTCATGGG - Intergenic
1088118703 11:106342016-106342038 GTGGCTGGGGCTGGCGTTGTGGG + Intergenic
1092460515 12:8681945-8681967 CTGGGTGGGAGCAGTCTTGTGGG + Intronic
1094020114 12:25904936-25904958 CTGTCTAAGGCCACTGTTGTAGG - Intergenic
1094201378 12:27797907-27797929 CTGGCGGGTGACGGTGTTGTAGG - Exonic
1095306951 12:40650266-40650288 CTGGGTGGGGCCACAGTAGTAGG + Intergenic
1095783293 12:46084381-46084403 CTGGCTGGAGCCAGCATTGCAGG + Intergenic
1095955049 12:47801118-47801140 CTGGCTGGGTCCAGGGATGAGGG - Intronic
1096614353 12:52823323-52823345 CTGGTTGGGGGCAGGGATGTGGG - Intronic
1096784338 12:54008689-54008711 ATGGCTGGGGCCAGTTTTCCAGG - Intronic
1098327985 12:69322593-69322615 CTGGAAGGGGCCAGCTTTGTTGG - Intergenic
1099413719 12:82361676-82361698 CTGCCTGGGGCCAGCGGTGCTGG + Intronic
1102231563 12:111266006-111266028 CTGTCTGGGGCAACTGTAGTGGG + Intronic
1104515853 12:129426009-129426031 CTTTCTGCTGCCAGTGTTGTGGG - Intronic
1104780682 12:131417953-131417975 ATGGCTGTGGGCAGTGATGTGGG - Intergenic
1105593874 13:21818045-21818067 CTGCCTGGGGCCAGTGGCGCCGG - Intergenic
1105878336 13:24580554-24580576 CTGGCTGTTGCCAGTGCTGCTGG + Intergenic
1105921517 13:24968519-24968541 CTGGCTGTTGCCAGTGCTGCTGG - Intergenic
1108609641 13:52071533-52071555 CTGGCTGGGGCCAGTGTTGTGGG - Intronic
1108626747 13:52236368-52236390 CTGGCTGTGGCCAGTGGTGCTGG - Intergenic
1108659321 13:52570117-52570139 CTGGCTGTGGCCAGTGGTGCTGG + Intergenic
1108845657 13:54676672-54676694 CTGCCTGGGGCCAGTGGCGCCGG - Intergenic
1109515522 13:63438963-63438985 CTGGCTGGGGACAGTGCTGCTGG + Intergenic
1110434038 13:75459270-75459292 CAGTATGGGGTCAGTGTTGTGGG - Intronic
1112528455 13:100176194-100176216 GAGGCTGTGGTCAGTGTTGTTGG + Intronic
1112594438 13:100795105-100795127 ATGGATGGGGCCAGTGTGGGAGG - Intergenic
1113768550 13:112894933-112894955 GTGGCTGGGGACAGTGCTGGAGG + Intronic
1117502270 14:56364887-56364909 CTGACTGGGGCCAGCGTTGTGGG - Intergenic
1117857980 14:60055603-60055625 CTGGCAGGGGCCAGGCTTGGCGG + Intronic
1118228602 14:63927026-63927048 GTGGCTGGAGCCAGGGGTGTAGG + Intronic
1119388949 14:74277035-74277057 CTTGCTGGGGGCAGAGTTCTTGG + Intergenic
1120815393 14:88851692-88851714 CTGGCTGGGGGCAGGGTGGTGGG + Intronic
1122205810 14:100147436-100147458 CTGGCTGAGGCCAAGGTTGGCGG - Intronic
1123631073 15:22259590-22259612 CTGCTTGGGGCCTGTGTTGCTGG + Intergenic
1125578907 15:40772274-40772296 CTGGCTGGGCCATGTGTTGGTGG + Exonic
1126167827 15:45668516-45668538 CTGGGAGGGGCCAGTGGTGAGGG + Intronic
1126253594 15:46598197-46598219 CTGGCTGAGGCCACTGTGTTTGG + Intergenic
1126387921 15:48112878-48112900 CTGGCTGGGGCCGGTGTTATGGG - Intergenic
1128250954 15:66164063-66164085 CTACCTGGGGGCAGGGTTGTTGG + Intronic
1128780437 15:70355513-70355535 CTGGCTGTGGACAGAGGTGTAGG - Intergenic
1129743367 15:78001059-78001081 CCGGCTGGTGCCAGTGTGGCTGG - Intronic
1130349675 15:83079878-83079900 CTGGCTGGCACCAGGGTTCTAGG + Intergenic
1130667945 15:85885523-85885545 CTGGCTGGCGCCGGTGTTCTGGG + Intergenic
1131657480 15:94476812-94476834 CAGGTTGGGGCCACTGTTGGTGG - Intronic
1131912582 15:97224349-97224371 CTGCCTGGGGCCAGTGTCACCGG - Intergenic
1132553418 16:562697-562719 TTGGCAGGGGCCAGGGTTGCTGG + Intronic
1132724716 16:1333760-1333782 CGGGCTGCGGCCAGTGCTGTTGG + Intronic
1132826699 16:1908798-1908820 CTGGCAGGTGCCAGTGTGGTGGG + Intergenic
1132864577 16:2087116-2087138 CTGGGTGGGCACAGTGTAGTTGG + Intronic
1134239596 16:12495705-12495727 CTGGATGGGGTCAGTGTGGCTGG + Intronic
1134425212 16:14135816-14135838 CTGGATGGGGCCAGTGTAGAGGG - Intronic
1135861230 16:26057931-26057953 CTCACTGGGGCCAGGGTTGAAGG + Intronic
1138083027 16:54109618-54109640 CTGGCTGGGGCCAGGCGTGGTGG - Intronic
1138681244 16:58684862-58684884 CTGGCTCAGGGCAGTGCTGTCGG - Intronic
1138955928 16:61970769-61970791 CTGACAGGGGCCAGTCTTGTGGG - Intronic
1139940837 16:70604348-70604370 TTCGATGGGGCCAGTGGTGTAGG - Intronic
1139955173 16:70689763-70689785 CAGGCTGTGGGCAGTGTTCTAGG + Intronic
1141152274 16:81572485-81572507 GTGGACGGGGCCAGTGTTCTTGG + Intronic
1142226419 16:88879926-88879948 CTGGGTGGGGCCAGAGGTGAAGG - Intronic
1142292100 16:89197900-89197922 GTGGCTGGGGCAGGTGTTTTAGG + Intronic
1142642391 17:1291873-1291895 CTGGCTGGGCCCAGTGGTTGTGG + Intronic
1142901492 17:3014899-3014921 CTGGCTGCGGCCAGGCTTGGTGG + Intronic
1144688054 17:17239318-17239340 GTGGCTGAAGCCAGTGGTGTTGG - Intergenic
1144779266 17:17799734-17799756 CCGGCTGGGGCCACTGTGCTGGG - Intronic
1144833407 17:18144087-18144109 CTGGCTGTGCCCTGTGGTGTTGG + Intronic
1145207628 17:20992932-20992954 CAGGCTGGGGCAAGTATTTTTGG + Intergenic
1148865681 17:50626934-50626956 CTGCCTGGAGCCAGAGTTGCCGG - Exonic
1150596434 17:66610038-66610060 ATGGTGGGGGGCAGTGTTGTGGG - Intronic
1151393259 17:73802010-73802032 CTGGAGGGGGCCAGTGTTTAAGG - Intergenic
1151473685 17:74333105-74333127 CTGCCTGGGGGCAGTGAGGTGGG + Intronic
1152298876 17:79484133-79484155 CTGGGTGGTGCCAGTGGTGGGGG - Intronic
1152879549 17:82807314-82807336 CTGGGTGGGGCCCTTGATGTTGG + Intronic
1153098344 18:1435439-1435461 CTGGCTGGTGGCAGTGAAGTTGG - Intergenic
1153582966 18:6593939-6593961 CTTGCTGGGGGCAGTGTCGGGGG + Intergenic
1154499873 18:14990652-14990674 CTGGCAGGGACCAGTGCTGGAGG + Intergenic
1155023987 18:21924201-21924223 TTGGCTGGGTGCAGTGGTGTGGG + Intergenic
1155264633 18:24079353-24079375 CTGACAGGGGCCAGTGGTGGAGG + Intronic
1157536835 18:48465723-48465745 CTGGATGTGGCCAGTGGTCTGGG - Intergenic
1157590014 18:48830761-48830783 CAGGCTGGGGACAGTGGTGGGGG - Intronic
1158782807 18:60670927-60670949 CTGGCAGGGGCCAGCATTGTGGG - Intergenic
1159938412 18:74387017-74387039 CTATCTGGGGCCAGTGATGTGGG - Intergenic
1160810146 19:1009803-1009825 CTGGCTGCTGCCACTGATGTTGG + Exonic
1162177063 19:8838666-8838688 CTGGCTGGGGCTGGCATTGTTGG + Intronic
1162566296 19:11447194-11447216 CGGGGTGGGGGCAGTGTGGTGGG - Intronic
1163148469 19:15397991-15398013 CAGGCTGGGACCAGTGGGGTCGG + Intronic
1163827667 19:19532756-19532778 CTGGTTGGGGTCAGGGTTGGGGG - Intronic
1163830010 19:19543117-19543139 CTGAATGGGGCCAGTCTTGCTGG + Intronic
1166956181 19:46466411-46466433 CTGGCTGGGGGCACTGTTTGAGG + Intergenic
1167221438 19:48201434-48201456 CTAGCTGGGGCCAGTATCATGGG - Intronic
1167500625 19:49845099-49845121 CTGGCAGGGTGCAGTGTGGTGGG - Intergenic
925869029 2:8253366-8253388 CCGGCTGCTGCCAGTGCTGTGGG - Intergenic
928376965 2:30783280-30783302 CTTGCTGAGACCAGGGTTGTAGG + Intronic
928451924 2:31385416-31385438 CTGGCTTGGGTCAGTGCTGATGG - Intronic
931430998 2:62208947-62208969 CTGGGTGGGGGCAGTGGGGTGGG + Intronic
931564220 2:63597440-63597462 CTGGATGTGGCCATTCTTGTGGG + Exonic
931972728 2:67607478-67607500 CTGGCTGGGGCTGGGGTGGTTGG - Intergenic
933140984 2:78792679-78792701 CTGACTGGGGGCATTGTTTTGGG + Intergenic
933363872 2:81324240-81324262 CTGGCTGTGGCCAACGTTGCTGG + Intergenic
933723125 2:85410595-85410617 CGGGCTGAGGCCACTGTGGTGGG - Intronic
934699369 2:96427589-96427611 CTAGCTGGGGCTGGTGGTGTGGG - Intergenic
934915002 2:98294437-98294459 CTGGCTGTTGCCACTGTTGTCGG + Intronic
935334756 2:102006183-102006205 CTGGCTTGGACCAGTATAGTTGG + Intronic
937369405 2:121286944-121286966 CTGACTGGGGACAGTGCTGATGG + Intergenic
937861511 2:126714980-126715002 GTTGCTGGGGCCAGTGTGGATGG - Intergenic
938493403 2:131777660-131777682 CTGGCAGGGACCAGGGTTGGAGG - Intergenic
938832924 2:135071477-135071499 CTGGCTGGGGCTGGTGTTGCAGG + Intronic
938833388 2:135074686-135074708 CTGGTTGGGGCCAGTGTCATGGG + Intronic
942165269 2:173235072-173235094 CTGGCTGGGGCCGCTGTCGCAGG + Intronic
942779344 2:179622870-179622892 CTCACAGGTGCCAGTGTTGTAGG - Intronic
943134426 2:183892636-183892658 CTGCCTGGGGCCAGTGGTGCCGG - Intergenic
944080940 2:195787828-195787850 CTGGATGGGCCCACTGTTGGAGG - Intronic
945631777 2:212287272-212287294 CTGGCTGGGGCTGGTGTTGCCGG - Intronic
946051523 2:216866728-216866750 CTAGCTGGGGCTGGTGTTGTGGG + Intergenic
946144999 2:217724046-217724068 CTTGCTGGGGGCTGTGTGGTCGG - Intronic
947171901 2:227320729-227320751 CTGCCTGGGGCCAGCGGTGCTGG - Intergenic
948197730 2:236107736-236107758 CTGGCTGGGGCCAGAGTACCCGG + Intronic
948899137 2:240947344-240947366 CTGGCTGGGGCCTGTGTTCTGGG - Intronic
1168932182 20:1632746-1632768 ATGGCTGGGGCTGGTGTTGGGGG - Intronic
1169505582 20:6208122-6208144 GTGGCATGGGCCAGTGTTGGTGG + Intergenic
1170295271 20:14818144-14818166 CCTGCTGGGGCCACTGTTCTAGG + Intronic
1173163050 20:40666399-40666421 CTGGTGGGGGACTGTGTTGTGGG + Intergenic
1175357496 20:58380509-58380531 GGGGCTGGGGGCAGTGTTTTGGG - Intergenic
1175965292 20:62657285-62657307 GTGGCTGAGGGCAGTGTTGCAGG + Intronic
1176739663 21:10589355-10589377 CTGGCTGTTGCCAGTGCTGCTGG + Intronic
1176964726 21:15199362-15199384 CCAGCTGGGGCCAGAGTTGGGGG - Intergenic
1179075073 21:38113396-38113418 CTGGCTGGGTCCAGCATTGCAGG - Intronic
1179123019 21:38566343-38566365 CAGTGTGGGGCCACTGTTGTGGG - Intronic
1179483808 21:41696214-41696236 CTTGCTGGCTCCAGTGTGGTAGG + Intergenic
1179538879 21:42071344-42071366 CTGGCTCTGGTCAGTGCTGTGGG + Exonic
1179802266 21:43816611-43816633 CTGTCTGGGGCCAGGGGGGTTGG - Intergenic
1179886329 21:44315764-44315786 CTGGCTGGTGCCAGCGATGCGGG + Intronic
1180078573 21:45475664-45475686 CTGGCTGGGGACAGGGATGCTGG + Intronic
1182096634 22:27630432-27630454 CTGGCTGGGGACAGGGGTGTGGG - Intergenic
1182389204 22:29977001-29977023 CTGTGTGGGGCCAGTCTTGGTGG + Intronic
1182620322 22:31615130-31615152 CTGTGTGGGACCAGTGCTGTCGG - Exonic
1183037430 22:35150798-35150820 ATGGCTGGGGACAGTGATGGTGG - Intergenic
1183367906 22:37416946-37416968 CTGGCTGCGCACAGTGTTGGTGG - Intronic
1183510064 22:38229544-38229566 CTGGGTGGGGGCAGTGTGGTGGG - Intronic
950494780 3:13327258-13327280 CTGTCTGGGGCCATGGTGGTGGG - Exonic
950548392 3:13652565-13652587 CAGGCTGGAGCCAGAGTTGAAGG + Intergenic
951551892 3:23882794-23882816 CTGCCTGGGGCCAGTGGCGCCGG + Intronic
951867397 3:27323399-27323421 GTGGTTGGTGCAAGTGTTGTTGG + Intronic
952970639 3:38648685-38648707 CTGGTGGGGGCCAGAGGTGTGGG - Intronic
954124602 3:48521067-48521089 CTGCTTGGGGGCAGTGGTGTTGG + Intronic
954168716 3:48782152-48782174 CTGGCTGGTGGCAGTGAGGTGGG - Intronic
954332585 3:49898826-49898848 GGGCCTGGGGCCAGGGTTGTGGG - Intronic
956088182 3:65635843-65635865 TTGGCTGGGGCCAGAGTTCTAGG + Intronic
959793109 3:110388356-110388378 CTGGCTGGGGCCACTGTCTGTGG - Intergenic
959936300 3:112032767-112032789 CTATCTGGGGCCAGTGGTGCAGG - Intergenic
960029137 3:113040170-113040192 CTGGCTGGGGCTGGCGTTGCAGG + Intergenic
960685493 3:120289824-120289846 CTGCCTGGGGCCAGTGGGGCCGG - Intergenic
961386176 3:126524538-126524560 CTGGCTGGGGCTAGGGGTGGCGG + Intronic
961452960 3:127010681-127010703 CTGGCTGGGACCTGGGTTCTGGG + Intronic
964550251 3:157877531-157877553 CTGGAAGTGGCCAGTCTTGTGGG - Intergenic
965506506 3:169521175-169521197 CTGGTTGGGTCCAGAGTTCTGGG + Intronic
967751173 3:193118083-193118105 CTGGCTGGGGCCAGCATTGCAGG + Intergenic
967888223 3:194347370-194347392 GTGTCTGGGGCCAGGGTTCTAGG - Intronic
968323366 3:197791249-197791271 CTGGCGGGCCCGAGTGTTGTCGG + Intronic
968481921 4:837077-837099 ATGGCTGGGGCCAGGGGTCTGGG - Intergenic
969272912 4:6115003-6115025 CTGGCTGAGCCTTGTGTTGTTGG - Intronic
969409148 4:7016440-7016462 CTGGCTGGGGCCCGCGGTGCTGG + Intronic
969569743 4:8001469-8001491 CTGCCTGGGGCCACTGTCCTCGG + Intronic
969697974 4:8746010-8746032 CAGGCTGGGGCCAGCGCTGCAGG + Intergenic
969701710 4:8771288-8771310 TTGCCTGGGGCCACTGTTGCTGG - Intergenic
970064275 4:12073996-12074018 GTGGCTGGGAACAGTGGTGTTGG - Intergenic
971214411 4:24650163-24650185 CTGGATGTGGCCAGGGTGGTGGG + Intergenic
971298473 4:25422876-25422898 CTGGCTGAGACCATTGTTCTGGG + Intergenic
971730328 4:30370644-30370666 CTGACTGGGGCGAGTGTTTTTGG - Intergenic
972745913 4:41932699-41932721 CTGGATTGAGGCAGTGTTGTTGG - Intergenic
972842960 4:42953160-42953182 CTTGCTGTGGCCATTGTTTTTGG - Intronic
974766103 4:66348640-66348662 CCAGCTGGGGCCAGAGTTGCAGG + Intergenic
977021706 4:91768534-91768556 CAGGCTGGGGCTGGTGATGTGGG + Intergenic
977641156 4:99359786-99359808 CTGCCTGGGGCCGGTGGTGCCGG - Intergenic
978072208 4:104488186-104488208 CTGGCTGAGGGCAGTGATTTGGG - Intronic
979324383 4:119361809-119361831 GTGGCTTGGGCCTGGGTTGTTGG + Intergenic
979335296 4:119455144-119455166 CTGCCTGGGGGAGGTGTTGTGGG - Intergenic
980569045 4:134586430-134586452 CTATCTGGGGCCAGTGTCATAGG - Intergenic
981188029 4:141828050-141828072 ATGGATGGGGGCAGTCTTGTGGG + Intergenic
981499952 4:145439303-145439325 CTTGCAGAGGCCAGAGTTGTGGG - Intergenic
983242220 4:165246506-165246528 GTGGCTTGGGCCTGGGTTGTTGG + Intronic
984277494 4:177627590-177627612 CTGGCTGGGGCCGGCGTTGCAGG + Intergenic
984879425 4:184397630-184397652 CTGGTCGGAGCCAGTGTTGGGGG + Intronic
985541213 5:488577-488599 CTGGCTGGCGCCGGTGGCGTGGG + Intronic
985544125 5:500690-500712 GTGGATGGGGCCAGTGTGGATGG + Intronic
985619088 5:944281-944303 CTGCCTGGGGCCAGTGGGGAGGG + Intergenic
985956188 5:3267962-3267984 ATGGCTGAGGCCAGGGCTGTGGG - Intergenic
987084485 5:14456127-14456149 CTGCCTGGGGCCAGTGGCGCTGG + Intronic
987827676 5:23054724-23054746 CTTGATGGGGGCAGTTTTGTTGG + Intergenic
990019500 5:51107814-51107836 CTGTCTGGAGCCAGTGATGGTGG + Intergenic
991430265 5:66537299-66537321 CTGGCTGGGAACAGGGTTGATGG - Intergenic
992283366 5:75205381-75205403 ATGTCTGGGGCCAGTGCTGGAGG - Intronic
995664303 5:114523946-114523968 ATGGCTGGGTTCAGTGTTGGAGG - Intergenic
995682112 5:114731668-114731690 CTGGCTGTGGTGAGTGTTGGAGG + Intergenic
996445486 5:123544340-123544362 CTAACTGGGGCCGGTGGTGTAGG - Intronic
997600517 5:135135391-135135413 CAGGCTGGGGCCAGCATTGTTGG + Intronic
998273882 5:140733284-140733306 GTGGGTGGGGCCATAGTTGTTGG - Intergenic
999705545 5:154269602-154269624 GTGGCTGGGGCCAGTGGACTTGG + Intronic
1000296484 5:159916973-159916995 CTGGTTGGGGCCAGTGAAGTTGG - Exonic
1001235308 5:170024289-170024311 CTGGATGGTGACAGTGTTGGGGG + Intronic
1001954924 5:175842640-175842662 CTGGCTGGGGCCAGGGGAGGAGG - Intronic
1002279227 5:178120979-178121001 GTGGCTGGGTCCTGTGGTGTAGG + Intronic
1003259807 6:4506839-4506861 CTGGCTGGAGCCAGAGTGGCTGG + Intergenic
1003271106 6:4608766-4608788 CAGGCTGGGGCCTGTGCTTTGGG + Intergenic
1003820951 6:9896489-9896511 CCAGCTGGGGTGAGTGTTGTTGG - Intronic
1004481629 6:16025085-16025107 CTGAATGGGGCCTGAGTTGTTGG + Intergenic
1005994904 6:30925270-30925292 CTGGCTGGCGCCAGTGCTCCTGG - Exonic
1007170234 6:39857514-39857536 CTGGATGGGGCAAGTGGTGGGGG + Intronic
1007399384 6:41595096-41595118 CTGGCTGGGGGAAGGGGTGTGGG + Intronic
1008922381 6:56855917-56855939 CTGGCTGGGGCCACTGTCAGTGG - Intronic
1011090747 6:83596199-83596221 CTGGCTGGGCATAGTGCTGTAGG - Intronic
1011410007 6:87058207-87058229 CTGGCTGGGGCCAGGCGTGCTGG - Intergenic
1013409465 6:109871276-109871298 TTGGCTGGGGCCAGTGTTGCAGG + Intergenic
1015021649 6:128483088-128483110 ATTGCTGGGCCTAGTGTTGTTGG - Intronic
1015314489 6:131803236-131803258 CAATCTGGGGCCAGTGGTGTGGG + Intergenic
1017508609 6:155092042-155092064 CTAGCCGGGCCCAGTGGTGTGGG - Intronic
1017826239 6:158084105-158084127 CTGGGAGGAGCCAGTGCTGTGGG - Exonic
1017838794 6:158204719-158204741 CAGGTTGGGGCCAGTGCTGCTGG - Intergenic
1018906875 6:168080642-168080664 CAGGCAGGGGCCAGGGTTGGGGG + Intronic
1019264967 7:109995-110017 CGGGATGGGGCCAGTGATGTCGG - Intergenic
1019513514 7:1429890-1429912 CTGGCTGGGGCAAGAGTTGGAGG - Intronic
1019962195 7:4470070-4470092 CTGGCTGGGGCCAGGTGTGATGG + Intergenic
1020636608 7:10703185-10703207 CTTGCTGGGGGCAATGTTGCAGG + Intergenic
1020881056 7:13763874-13763896 GTGGCTGGAGCCAGAGTTGTTGG - Intergenic
1021503960 7:21360500-21360522 GATGCTGGGGCCAGTGTTTTGGG - Intergenic
1022523070 7:31020203-31020225 CTGGCTGGGGACAGGAGTGTGGG + Intergenic
1023677979 7:42650858-42650880 TGGGCTGGGGCCAGTGGGGTAGG - Intergenic
1023968320 7:44975008-44975030 CTGGTTGGGGTGAGTGTGGTGGG + Intronic
1024068784 7:45768627-45768649 CTGGCTGGTGGAGGTGTTGTGGG + Intergenic
1025834311 7:65080914-65080936 ATGGCTGGGGGAAGTGTTGGGGG + Intergenic
1025904081 7:65770434-65770456 ATGGCTGGGGGAAGTGTTGGGGG + Intergenic
1026621096 7:71950543-71950565 CTGTTTGGGGCCAGAGTGGTGGG - Intronic
1026929221 7:74213909-74213931 ATGGCTGGGGACAGAGTTGAGGG - Intronic
1027002015 7:74659998-74660020 CAGGCTGAGGCCTGTGGTGTGGG + Intronic
1027052459 7:75028780-75028802 CGGGCTGAGGACAGTGGTGTGGG - Intronic
1028234766 7:88347363-88347385 CTAGCTAGGACCAGTGGTGTGGG + Intergenic
1029318083 7:99732714-99732736 CTGTCTGGGGCCAAGCTTGTGGG - Intronic
1032453685 7:132055991-132056013 CTGGCTGGTGCCTGGGTTGGTGG - Intergenic
1033043733 7:137941612-137941634 CTGGCTGGGGCTAGCAATGTGGG - Intronic
1033147747 7:138885550-138885572 CTGGCTGGGGCCATCGTTGTGGG - Intronic
1034929905 7:155153453-155153475 AGGGCTGGTGACAGTGTTGTAGG - Intergenic
1035173540 7:157034061-157034083 GGAGCTGGGGCCAGTTTTGTTGG + Intergenic
1038692386 8:29774874-29774896 AGGGCTGGGGCCAGAGCTGTGGG + Intergenic
1040027683 8:42796706-42796728 GTGCCTGGGGCCAGTGGTGCTGG - Intergenic
1040701771 8:50074964-50074986 CTGCCTGGGGCCAGTGGCGCCGG - Intronic
1041870372 8:62627413-62627435 CTGGCTGGGACCAGGGATGGTGG + Intronic
1042488927 8:69377463-69377485 GTGGAGGGGGGCAGTGTTGTGGG - Intergenic
1045189061 8:99865473-99865495 CTGGCGGAGGCCTGTTTTGTTGG - Intronic
1046711659 8:117517794-117517816 CTGGATGGGGCAAGTGTAGCAGG + Intergenic
1048007401 8:130430678-130430700 CTGCCTCGGGTCAGTGTTCTGGG - Intronic
1048573353 8:135672557-135672579 CAGGCTGGGGCCAGGGCTGAGGG - Intergenic
1048686157 8:136907387-136907409 CTGACAGGGGCCATTGTTTTGGG + Intergenic
1049113437 8:140664756-140664778 CTGGTTGGGGCCAGTGTTAGAGG + Intronic
1049661227 8:143820502-143820524 CGTGGTGGGGCCAGTGGTGTGGG - Intronic
1050891993 9:10836058-10836080 CTGCCTGGGGCCGGTGGTGCTGG - Intergenic
1052814816 9:33093791-33093813 CTGGGTGGGGACTGTGTGGTGGG + Intergenic
1055908959 9:81325853-81325875 CTGGCTGGGGCCAGGGGCGGTGG - Intergenic
1057913265 9:99036325-99036347 ATGGATGGAGCCAGTATTGTGGG + Exonic
1058365172 9:104200697-104200719 CTGCCTGGGGCCAGCGGTGCTGG - Intergenic
1061059477 9:128243404-128243426 CTGGGTGGGGCCTGTGATTTTGG + Intronic
1061225971 9:129281199-129281221 CTGCCAGGGCCCTGTGTTGTGGG + Intergenic
1061408959 9:130408002-130408024 CTGGATGGTGCCAGGGTTGGAGG + Intronic
1061815506 9:133192181-133192203 CTGGGTGGGGCCTGTGGTGGAGG + Intergenic
1061885835 9:133590757-133590779 CTGGCTGGGGGCAGAGTTTCCGG - Intergenic
1061893375 9:133634421-133634443 CCAGCTGGGGCCCGCGTTGTGGG - Intergenic
1061899073 9:133663799-133663821 CTGGCTGGGTCCAGGGTCCTGGG + Exonic
1061938594 9:133872147-133872169 CTGGCCAGGGCCAGGGATGTGGG + Intronic
1062043928 9:134416558-134416580 CTGGCAGGGCCCAGTGTCCTTGG + Intronic
1062585496 9:137247615-137247637 GTGGCTGGGGCCAGGGCTGCAGG - Intronic
1185736970 X:2501829-2501851 CTGGCTGGGGCCTGTGGTCCGGG - Intronic
1186033704 X:5397392-5397414 CTGGCTGGGGCCAGCATCGCTGG + Intergenic
1186360339 X:8834794-8834816 CTGGCTGTGGCCGGTGTGATGGG + Intergenic
1186467441 X:9794721-9794743 CTGGCTGGGGCCAGAGTCACGGG - Intronic
1189308936 X:40006684-40006706 CTGGCTAGGGGCAGAGTTTTGGG - Intergenic
1190292061 X:48999764-48999786 CTGACTGGGGGCAGTGCTCTGGG - Intronic
1191871615 X:65751184-65751206 CTAGCTGGGGCTGATGTTGTGGG - Intergenic
1191913071 X:66172478-66172500 CTTCCTGGGGCCAGTGTTGCAGG + Exonic
1192906175 X:75553517-75553539 CTTGGTGGGGCCAGGGTTGGGGG - Intergenic
1193502595 X:82297849-82297871 ATGGCAGGGGCCATTGGTGTGGG - Intergenic
1193753897 X:85382745-85382767 CTGAATGGGGACAGTCTTGTGGG - Intergenic
1194553798 X:95332931-95332953 CTTGCTGGAGCCACTGTTGGGGG - Intergenic
1195128980 X:101836677-101836699 CAGCTTGGGGTCAGTGTTGTGGG - Intronic
1195146771 X:102026327-102026349 CTGGCTGGATCCAGTGGTGGTGG + Intergenic
1195254337 X:103078503-103078525 CAACCTGGGGCCAGTGGTGTGGG - Intronic
1195415732 X:104618206-104618228 CTGGCTGTGGCCAATGCAGTGGG + Intronic
1195564180 X:106323098-106323120 TTGGATGGGCCCAGTGTTGGGGG - Intergenic
1196613844 X:117744034-117744056 CTGGCTGTGGCCAATGTGGCTGG - Intergenic
1196837125 X:119823849-119823871 AAGCCTGGGGCCAGTGTTGGTGG - Intergenic
1197141492 X:123122129-123122151 CTGGCTGGGGCCAGGCTGGCGGG - Intergenic
1197863473 X:130994752-130994774 GTGGTTGGGTCCAGTGTGGTTGG - Intergenic
1199874522 X:151920098-151920120 CTGGATGGGGATAGTGGTGTTGG - Intronic
1200234354 X:154461033-154461055 CTGGCGGTGGCCCGTGATGTTGG + Intronic
1201638604 Y:16153807-16153829 CTGGCTGGGGCCAGCATCATGGG - Intergenic
1202597962 Y:26563207-26563229 CTGGCTGTTGCCAGTGCTGCTGG + Intergenic