ID: 1108612611

View in Genome Browser
Species Human (GRCh38)
Location 13:52098908-52098930
Sequence CCTCATGAACATGTGCAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 1, 2: 1, 3: 13, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108612609_1108612611 -5 Left 1108612609 13:52098890-52098912 CCAAACAATAAGCTTGTACCTCA 0: 1
1: 0
2: 1
3: 8
4: 91
Right 1108612611 13:52098908-52098930 CCTCATGAACATGTGCAGATAGG 0: 1
1: 1
2: 1
3: 13
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108612611 Original CRISPR CCTCATGAACATGTGCAGAT AGG Intronic
903860710 1:26362909-26362931 CCTCCTGAGCAAGTGGAGATGGG - Intronic
907490255 1:54804925-54804947 CCTCAGGAACATGCACAGAACGG - Intergenic
909178893 1:72395227-72395249 CCTCATGTACATATGCACACAGG + Intergenic
910168344 1:84351821-84351843 TCTCATGGAAATGTCCAGATAGG + Intronic
913104026 1:115595360-115595382 CAGCATGGATATGTGCAGATTGG + Intergenic
914854899 1:151343702-151343724 GCACATGGGCATGTGCAGATCGG + Exonic
917129894 1:171730527-171730549 CCTCATCAAGATGAGCATATTGG - Intronic
919755130 1:201061896-201061918 CCTCATGGACATGGTCAGGTAGG - Intronic
920333482 1:205228561-205228583 CACCATGAAGAGGTGCAGATCGG + Exonic
921851634 1:219938309-219938331 CCTCATGGAAATGTGAAGCTTGG - Intronic
1062927084 10:1325286-1325308 CCTCATGAAGAGGTGAAGAGAGG - Intronic
1065146465 10:22773288-22773310 CCTCATTAAAATGTGGACATAGG - Intergenic
1066053296 10:31657597-31657619 CCACATGAATAAGTGCAGAAGGG - Intergenic
1066089352 10:32002653-32002675 CCTCTTCAATATGTGCAGACAGG - Intergenic
1066985386 10:42461636-42461658 CTTCATGATCCTATGCAGATGGG + Intergenic
1069210321 10:65750360-65750382 ATTGATGGACATGTGCAGATTGG + Intergenic
1082581785 11:54879354-54879376 CCTAATGTACATTTGCAGAATGG + Intergenic
1083205814 11:61148376-61148398 CCTTTTTAACATGTGCAGGTTGG - Intronic
1084038443 11:66527740-66527762 CTTCATGATCATGTGTAGAAGGG + Intronic
1084178016 11:67433485-67433507 ACTCAGGAACACGTGCAGAATGG - Intronic
1085216180 11:74834825-74834847 TTTCATGACCATGTGCAGAGGGG - Intronic
1086198404 11:84170022-84170044 TCTCATGAACATGAGGATATAGG - Intronic
1087082708 11:94187182-94187204 CCTTCTGAACATGTCCAGAGTGG + Intergenic
1088727661 11:112653809-112653831 CTTCATGAAAATGCGCAGTTGGG - Intergenic
1091156460 11:133378855-133378877 CCTCCTGAATATGAGCAGCTAGG + Intronic
1092105224 12:5917031-5917053 CCTCATGAAGAAGTGCTGAGTGG + Intronic
1095141701 12:38671797-38671819 ACTCATGAACATGTGTAGAAAGG - Intronic
1098903571 12:76138336-76138358 CCTCCTGAACATGGACTGATTGG + Intergenic
1105026019 12:132849576-132849598 CCACCTGAATATGTGCAGTTGGG - Intronic
1105202551 13:18192551-18192573 CCTCACCAACATCTGCAGAATGG - Intergenic
1105575010 13:21642449-21642471 CCTCAAGCACATGAGCAGAATGG + Intergenic
1108612611 13:52098908-52098930 CCTCATGAACATGTGCAGATAGG + Intronic
1113175056 13:107554506-107554528 CCTCAAGAACCTGTGCAGCCCGG + Intronic
1118052078 14:62040252-62040274 CCTCATGAAGATATGGAGAGGGG + Intronic
1123679255 15:22746324-22746346 TCTCATGAACATGAGCAGAGAGG - Intergenic
1124331476 15:28820774-28820796 TCTCATGAACATGAGCAGAGAGG - Intergenic
1124963687 15:34417396-34417418 CCTCAGGAAAAAGAGCAGATGGG + Intronic
1124980308 15:34563622-34563644 CCTCAGGAAAAAGAGCAGATGGG + Intronic
1127005940 15:54570151-54570173 CCTCAAGGAAATGTACAGATAGG - Intronic
1128095315 15:64949731-64949753 CCTCCTGAACATGCCCAGGTGGG - Intronic
1128781248 15:70360020-70360042 GCTCATGTACCAGTGCAGATGGG + Intergenic
1129185132 15:73901443-73901465 TCTGATGAAGATGTGCACATGGG - Intergenic
1131927023 15:97395981-97396003 CCTCTTGTACAGTTGCAGATGGG + Intergenic
1133088821 16:3387514-3387536 CCTCATGAACTGGCCCAGATGGG - Intronic
1136655716 16:31707994-31708016 CCACATGAACATCTGCAGCTTGG - Intergenic
1141160252 16:81625008-81625030 TCTTATCAACATTTGCAGATGGG + Intronic
1141764889 16:86051831-86051853 CCCCATGGTCAAGTGCAGATGGG + Intergenic
1142063678 16:88047589-88047611 CCTCCTGAACATGTCCAGAAGGG + Intronic
1143052756 17:4140145-4140167 CCTTATGAAAATGTCCAGGTAGG - Intronic
1147501370 17:40967094-40967116 TCTCATAAACATGTGCATTTAGG + Intergenic
1151174957 17:72280306-72280328 GCTCATGCACATGTGCACACTGG + Intergenic
1152828153 17:82480394-82480416 CCTCCTGAACCTGTGCACATGGG - Intronic
1153473419 18:5470850-5470872 CCAGATAAACCTGTGCAGATGGG + Intronic
1156210693 18:34938340-34938362 ACTCATGGACATGTGCAGAGTGG - Intergenic
1156991164 18:43409505-43409527 CCCCATGAACATGTGGAGTTAGG + Intergenic
1158080821 18:53588621-53588643 TCTCCTGTACATGTGCAGTTTGG - Intergenic
1159739779 18:72153048-72153070 CCTCCCAAACATGTGCTGATCGG + Intergenic
1159830496 18:73272602-73272624 CATCCTGGACATGTGCAGAACGG + Intergenic
1165559082 19:36663455-36663477 CCTTATTAACATATGCAAATGGG - Intronic
1166008423 19:39923946-39923968 TATTATGAACATGTTCAGATTGG - Intronic
1168689158 19:58366570-58366592 CCTCATGCTACTGTGCAGATGGG - Intergenic
925822323 2:7812190-7812212 CCTCATGAAAATTTACAGAAAGG + Intergenic
930025510 2:47026975-47026997 CCGCGTGAACATGTTCAGAGGGG + Intronic
931591128 2:63884598-63884620 CCACATGAACTTGTACAGAAGGG + Intronic
932797311 2:74707923-74707945 CCTCACACACATGTGCTGATTGG - Intergenic
934523154 2:95032499-95032521 CCTCAGGGACAGGTGCTGATAGG + Intronic
938748058 2:134299689-134299711 CCTCATGAATTTTTTCAGATTGG + Intronic
938771516 2:134505019-134505041 TCTCATGCACATGTGCTCATAGG - Intronic
939483857 2:142783579-142783601 CCACATGAATTTGGGCAGATTGG + Intergenic
941577025 2:167245824-167245846 ACTCAGGAAGATGTGCAGAAAGG + Exonic
942930144 2:181481657-181481679 GCTCCTCAACATGAGCAGATTGG + Exonic
946943668 2:224797015-224797037 CCTCATGAAAAAGTACAGAAGGG + Exonic
948747618 2:240107719-240107741 CTTCATGAATATCTGCACATGGG + Intergenic
1169186877 20:3625707-3625729 CCTCAGGAACAAGTGCACTTGGG - Intronic
1169236707 20:3935634-3935656 ACTCATGAACATGTGCAGATGGG + Intronic
1169244018 20:4010905-4010927 CCTCTTGAACCTGTGCAGACAGG - Intronic
1170706664 20:18749855-18749877 GCTCATGAACAAGTTTAGATCGG + Intronic
1174586626 20:51613638-51613660 CCACAGGCACATGTGCAGAGGGG + Intronic
1175215021 20:57387663-57387685 CCTGATGAGGATGTGCAGAGAGG - Intergenic
1176715401 21:10345460-10345482 CCTCACCAACATCTGCAGAATGG + Intergenic
1180602950 22:17034492-17034514 CCTCACCAACATCTGCAGAATGG - Intergenic
1184521575 22:44997666-44997688 GTTCATTTACATGTGCAGATTGG + Intronic
951727821 3:25779658-25779680 CCTAGAGAACATGTGTAGATAGG - Intronic
952489773 3:33857042-33857064 TCTCATGAACATGAGCAGAGAGG - Intronic
953595362 3:44307489-44307511 CCTCAGGAATATGTGAAGAATGG - Intronic
956576089 3:70754281-70754303 CCTCATGAAAAGGTGCAGCTAGG + Intergenic
962010676 3:131387518-131387540 CCTGATGCACAGATGCAGATTGG + Intronic
962924051 3:139975598-139975620 CCTCAGACACATGTGAAGATAGG + Intronic
963917743 3:150874982-150875004 CATTATGAACATGTCCTGATTGG - Intronic
965132116 3:164714472-164714494 CCTCATAAACAGGTGCAGTTTGG - Intergenic
965474351 3:169136196-169136218 CCACATGAAAATGTACAGTTTGG - Intronic
966449740 3:180044350-180044372 CCTCATGAACATTTGCAGAAAGG + Intergenic
967023339 3:185542128-185542150 ATTCATGAACATGTGTAGAGTGG + Intronic
971563308 4:28109855-28109877 CCTCATGAATATGTGCATTCAGG + Intergenic
974443428 4:61948554-61948576 CCTCATGAACAGGGTAAGATAGG + Intronic
975909309 4:79248673-79248695 CAGCATGAACATGTGCATAGAGG + Intronic
977310382 4:95379456-95379478 ATTCATGAACATGTCCAGAGAGG - Intronic
979138510 4:117142234-117142256 CCTCATAAATATGTGCAATTAGG + Intergenic
981002440 4:139840659-139840681 CCTTATGAACAGGTGGAGGTGGG + Intronic
982304994 4:153921772-153921794 ACTCAGGAACATGTCCAGCTTGG + Intergenic
982714473 4:158792232-158792254 ACTCATGGACATATGCAGAGTGG + Intronic
984659046 4:182352927-182352949 CTTCCTGAACAACTGCAGATAGG + Intronic
984866256 4:184283231-184283253 CCTCATGAACCTGTGCCCACTGG - Intergenic
988464866 5:31479245-31479267 CCTTCTGAACATGTGAAAATGGG - Intronic
989852306 5:46229282-46229304 CCTAATGCCCATTTGCAGATTGG - Intergenic
993002191 5:82392458-82392480 ACTCATGAACATGTGGAAAGTGG + Intergenic
993201774 5:84825947-84825969 ACTCATGAACATCAGGAGATAGG + Intergenic
999285558 5:150392311-150392333 CCTCATGAAGTTGTACAGGTGGG - Intronic
1000425859 5:161090996-161091018 CTACATGGACATGTGTAGATAGG + Intergenic
1000950105 5:167471183-167471205 TCTCATGAATATGTAGAGATGGG - Intronic
1003592426 6:7447174-7447196 CCACAGGAACATGTCCAGCTGGG + Intergenic
1003601358 6:7520378-7520400 CCTCATTGACATGAGCAGACAGG - Intergenic
1005199464 6:23326592-23326614 CCACATGACCCTGTGCAGAGTGG + Intergenic
1005778559 6:29163704-29163726 CCCAATGAACATGTACAGAGAGG + Intergenic
1008698269 6:54067932-54067954 CCTCAAGAACATCTGAAGCTGGG + Intronic
1009260998 6:61487752-61487774 CCTAATGTACATTTGCAGAATGG + Intergenic
1009469400 6:64013471-64013493 CATCATCAACATGTTCAGAGAGG - Intronic
1010254682 6:73744686-73744708 CCTCATGAAAATTTGCATATGGG - Intronic
1012426527 6:99121240-99121262 CCTCAAGATCATATGCACATGGG + Intergenic
1013056433 6:106587735-106587757 CCTCCTGAACATGGACCGATTGG - Exonic
1013234594 6:108186211-108186233 CTTCATGACCACCTGCAGATAGG - Intronic
1014441236 6:121476378-121476400 CCTCTTGAACCTCTGCAGAAAGG - Intergenic
1019868232 7:3733314-3733336 CCTCCTAAATATGTGCAGGTAGG + Intronic
1021774288 7:24036901-24036923 GCTCATGAACATGTGGATGTTGG + Intergenic
1023347106 7:39281938-39281960 GCTCATGATCATGTGGAGAAAGG - Intronic
1023513720 7:40979634-40979656 CCTCATGAAGCTGTGTAGACAGG - Intergenic
1024521932 7:50312940-50312962 AATCATGAAAATGTGTAGATTGG + Intronic
1029881251 7:103812516-103812538 CCTCATGCACTTGTTCAGACAGG + Intronic
1032039945 7:128551034-128551056 CCTCCTGGACAGATGCAGATGGG - Intergenic
1032076185 7:128837252-128837274 CCCCAGGTACATGCGCAGATGGG + Exonic
1032680261 7:134175356-134175378 CTTGATGAACATGTCTAGATAGG + Intronic
1039153822 8:34533127-34533149 CCTCAGAAACTTGTGCAGTTGGG + Intergenic
1039923302 8:41907838-41907860 CGGCATGAAGATGTGCAGGTGGG - Intergenic
1043559637 8:81476959-81476981 CTCCAGGAACATGTGCAGAGTGG + Intergenic
1045208832 8:100073310-100073332 CCTCATGAGCATCAGCACATTGG - Intronic
1048925286 8:139265881-139265903 CCTCATGAACCTGTGAGGCTGGG - Intergenic
1050919245 9:11179785-11179807 CCTCATGTACATTTGCTAATCGG + Intergenic
1051420023 9:16879636-16879658 ACTCATCAACAGGAGCAGATGGG - Intergenic
1051439596 9:17070336-17070358 CCTCTTGTACATGTTCAGAGAGG - Intergenic
1054363850 9:64209809-64209831 CCTAATGTACATTTGCAGAATGG + Intergenic
1055089624 9:72349441-72349463 CCCTATGAACATATGCAGAGTGG - Intergenic
1056587751 9:87939416-87939438 CTTCATGATCATGTTCTGATTGG - Intergenic
1056609118 9:88113524-88113546 CTTCATGATCATGTTCTGATTGG + Intergenic
1060156522 9:121324112-121324134 TCCCATGAACACGTGCAGAGAGG - Intronic
1060715762 9:125927211-125927233 CCTAATAAACATCTACAGATTGG - Intronic
1190877652 X:54471083-54471105 CCTCAGGCAAAGGTGCAGATTGG - Intronic
1194774416 X:97944697-97944719 CAGCATGAACATGTGCACAGAGG + Intergenic
1195222672 X:102761548-102761570 CACCATGAACCTTTGCAGATAGG - Intergenic
1197721401 X:129747183-129747205 CCTCATGAATATGTACTGAAAGG + Intronic
1198011572 X:132561600-132561622 ACTGATGAATATGTGCAGACAGG - Intergenic
1202020043 Y:20454702-20454724 CTTCAGGGACATCTGCAGATGGG + Intergenic