ID: 1108614086

View in Genome Browser
Species Human (GRCh38)
Location 13:52114431-52114453
Sequence TTGTGAATTAGAAGCAACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 154}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108614086 Original CRISPR TTGTGAATTAGAAGCAACCA AGG (reversed) Intronic
906585460 1:46972996-46973018 TTGAGAATCAGAACCAAACAAGG - Intergenic
907914056 1:58852806-58852828 TTGAGAAGGAGAAGCGACCAGGG - Intergenic
908046608 1:60177145-60177167 TGGTGAATCAGAAGAAGCCAGGG + Intergenic
912911890 1:113769602-113769624 TAGTGAATAAGAAGCAACAAAGG + Intronic
912941688 1:114050744-114050766 TGGTGAATCAAAATCAACCAGGG - Intergenic
916499713 1:165376291-165376313 TTCTGAATTAAAAGAAAACAGGG + Intergenic
916846255 1:168653528-168653550 TTGTGAATTGGAAAGAACAAGGG + Intergenic
916949094 1:169760755-169760777 TTGAAACTTGGAAGCAACCAAGG - Intronic
917250439 1:173053922-173053944 TTCTGAATTCAAAGCAGCCATGG - Intergenic
920675228 1:208033733-208033755 TTGTGAATTAGAGACATCCTTGG + Intronic
922490159 1:226009877-226009899 ATGTGAATTTGAACCAAGCATGG + Intergenic
923425384 1:233863711-233863733 AAGTGAATTGGAAGCAAACATGG - Intergenic
1062930130 10:1347417-1347439 TTAGGAATGAGAAGAAACCAGGG + Intronic
1070639275 10:78154899-78154921 TTCTGACTTAGAAGCACGCATGG + Intergenic
1071014091 10:80974227-80974249 ATGTAAATTAGAACCAATCAAGG - Intergenic
1074151785 10:110766046-110766068 TTGCTAATTAGAGGCAGCCAAGG - Intronic
1074185393 10:111096472-111096494 TAGAGACTTGGAAGCAACCACGG + Intergenic
1076077612 10:127548145-127548167 TTTTGAATACAAAGCAACCAAGG - Intergenic
1079478310 11:20854859-20854881 CTGTGACTTAGCAGCATCCAAGG - Intronic
1080250011 11:30222735-30222757 TAGTGGATGAGAAGCATCCAAGG - Intergenic
1082870569 11:57941013-57941035 GTGTGAATTAGATTTAACCATGG + Intergenic
1085651230 11:78270413-78270435 TTGTGACTTAGAAGCAGCCATGG + Intronic
1088979823 11:114852160-114852182 ATGTGAATTGGAAACAACCATGG + Intergenic
1089113047 11:116072217-116072239 ATGGGAATTAGAAGCAGACAGGG - Intergenic
1093436193 12:19137995-19138017 TTGAGAATAAGAAGAAACGAAGG - Intronic
1095879020 12:47112518-47112540 TTGTTAAATAGAAACAGCCAGGG - Intronic
1096743573 12:53711613-53711635 CTGTGTATCAGAAGCAACCAGGG + Intronic
1098677713 12:73311835-73311857 TTGAGAACTAGAAGAAAACAAGG - Intergenic
1100420493 12:94427987-94428009 TTGTGATTTAGAAAGAAACAAGG + Intronic
1108537130 13:51395198-51395220 TTGTGAAATAAAAACAAACATGG + Intronic
1108614086 13:52114431-52114453 TTGTGAATTAGAAGCAACCAAGG - Intronic
1111227486 13:85293416-85293438 TTGAAAATTAGAATCACCCAGGG - Intergenic
1113125642 13:106975879-106975901 TAGTGAATTAAATGGAACCAGGG + Intergenic
1114685172 14:24522478-24522500 TTGTGATTGAGAAGCATACAGGG - Intergenic
1114763740 14:25347208-25347230 TTGTGAAATATAAGCCATCAGGG - Intergenic
1121860835 14:97316608-97316630 TTAGGAAGTAGAAGCAACCTGGG + Intergenic
1122727368 14:103766505-103766527 CTGTTGATTAGGAGCAACCACGG - Intronic
1124400046 15:29340120-29340142 CTGTCAATTAGATGCAACCATGG + Intronic
1127539567 15:59923264-59923286 TTGGAAATTAGAAGCAAGAAAGG + Intergenic
1129945240 15:79533969-79533991 CTGTGCATTAGCAGCATCCATGG - Intergenic
1132245542 15:100293487-100293509 TTATAAATTAGAAGTAACCGTGG + Intronic
1133099885 16:3472731-3472753 TTCTTAATTAAAACCAACCAGGG - Intronic
1133474932 16:6111718-6111740 TTTGGAATGAGAAGAAACCAAGG + Intronic
1138186130 16:54978960-54978982 TTGTGCATTTGAAGAATCCAGGG + Intergenic
1143791786 17:9302502-9302524 TTATGAATTCAAAGCATCCAGGG - Intronic
1144501801 17:15794460-15794482 TTGTGAATCACAGGCAAACATGG - Intergenic
1145118325 17:20232428-20232450 TAGTGATTGAGAAGCAAGCACGG - Intronic
1145163977 17:20597124-20597146 TTGTGAATCACAGGCAAACATGG - Intergenic
1146839328 17:36139076-36139098 TTGTGACTTGAAAGCAGCCATGG - Intergenic
1147499146 17:40945547-40945569 TTCTGAATAAGAAGCAACATTGG - Intergenic
1149119787 17:53148732-53148754 TTATAAATTAAAAGCAATCAAGG - Intergenic
1151122912 17:71812589-71812611 TTGAGAATCAGAAGCAGACAAGG + Intergenic
1151217658 17:72588816-72588838 GTGTGAATTTGAAGAAACCCAGG - Intergenic
1153597240 18:6740256-6740278 TTTTGAGTTGAAAGCAACCAGGG + Intronic
1155021946 18:21904527-21904549 TTGTGAATTATATGCAAGAAGGG + Intergenic
1156150584 18:34237012-34237034 TTGTAAAATAGAAGGAACCAGGG - Intergenic
1157033219 18:43938749-43938771 ATGTGAATTAGAAACATCCCTGG + Intergenic
1159684778 18:71405024-71405046 TTGTGACGTAGAGGCAAACATGG + Intergenic
1159953290 18:74501302-74501324 TTGTGGACAAGAAGCAACGAGGG - Intronic
929336622 2:40755565-40755587 CTGTGAATAAGAAACTACCAAGG - Intergenic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
931199402 2:60082935-60082957 TTGTCCAATAAAAGCAACCAGGG + Intergenic
932706545 2:74030653-74030675 TTGTGAATTAGAAGGCACCCTGG + Intronic
934519186 2:95008737-95008759 TTTTAAATTAGAAGCAAAAAAGG - Intergenic
935040646 2:99423413-99423435 TTGTGAATGGAAAGCAGCCACGG - Intronic
936993526 2:118390345-118390367 TTGTGAATTGTGAGCAACCTGGG + Intergenic
937414756 2:121705473-121705495 GTGTGACTTAGAGGAAACCAGGG - Intergenic
939129431 2:138216750-138216772 TTGTGACAGGGAAGCAACCATGG + Intergenic
940018727 2:149134246-149134268 TTGTAAATCAGAAGCAGCCAAGG - Intronic
942644910 2:178099630-178099652 TTGTGAATTAGAATACACAAGGG - Intronic
943429124 2:187775797-187775819 TTCTGGTTTAGAAACAACCAGGG + Intergenic
946503519 2:220275194-220275216 TTTTAAATTACAAGCAAACAAGG - Intergenic
947041699 2:225929243-225929265 TAGTGGATTAGAACCAACCCTGG + Intergenic
948112864 2:235471062-235471084 TTGTCAATTACAAACAAACAAGG - Intergenic
948546358 2:238732020-238732042 GTGTGAATTAGAAGCCACCTGGG + Intergenic
1169833846 20:9855644-9855666 TTGTGCTTTAGAAGCACTCAGGG - Intergenic
1170426506 20:16240600-16240622 TTGTGAATTTAAAGCACCAAGGG - Intergenic
1175105855 20:56614404-56614426 TTTTGCATTTGAAGGAACCAGGG - Intergenic
1181714592 22:24714979-24715001 TTGGGAGTTGGAAGCAACCTAGG - Intergenic
951628104 3:24688944-24688966 TGGTGAATCAGCAGCAAACAAGG - Intergenic
956250240 3:67227860-67227882 TTGTGAGTTGGCTGCAACCAGGG + Intergenic
957147131 3:76439205-76439227 TTGTGAATCAAAAGAAACAAAGG + Intronic
957234129 3:77562742-77562764 TTGTGAATTAGGAGAAATCTTGG + Intronic
957577541 3:82029245-82029267 TTCAGAACTAGAAGAAACCAGGG + Intergenic
960519923 3:118642978-118643000 TTCCGTATTAGAAGCCACCAAGG - Intergenic
960987090 3:123287759-123287781 TTGGGAAATAGAAGCCATCAGGG - Intronic
961178601 3:124857734-124857756 TGGTGAACTAGAAACAGCCATGG + Intronic
965584194 3:170301192-170301214 TTGTGTATTAGAAGGAACACTGG + Intronic
967511540 3:190319198-190319220 TTGAGAATTAGATGAAAACAAGG + Intronic
969067142 4:4494987-4495009 TTGTACATTAGAATCATCCAGGG - Intronic
969910440 4:10439743-10439765 TTTTGAATTAGATGCAATGATGG - Intergenic
973005496 4:45000663-45000685 TTATGAATTAGAAGTAAAGATGG + Intergenic
974525207 4:63042509-63042531 ATGAGAATTAGAAGGAGCCAGGG - Intergenic
976740537 4:88351966-88351988 GGGGGAATTAGAAGCAATCATGG + Intergenic
977240258 4:94560049-94560071 TGGTGGTTTAGAAGCATCCAAGG + Intronic
978989368 4:115059776-115059798 TTTTTAATTAGTAGCAACTAAGG + Intronic
979066393 4:116140581-116140603 TTGTTATTTAGAAGCAAACATGG + Intergenic
983144410 4:164195533-164195555 TTGTGCATTAGAAGGGACCCTGG + Intronic
983934204 4:173488408-173488430 TTATGAATTACAGGTAACCATGG + Intergenic
987116475 5:14730296-14730318 CTGTGAATGTGAAGAAACCATGG - Intronic
987365336 5:17143489-17143511 TGGTGAATTATAAACATCCATGG - Intronic
989290253 5:39756026-39756048 TTATAAATAAGAAGCATCCAGGG + Intergenic
991350738 5:65718230-65718252 CTGTGCATTAGCAGCATCCATGG + Intronic
991556880 5:67905047-67905069 TTGTCAAGTAGAACCAACGAGGG + Intergenic
995101346 5:108310988-108311010 TTGTCTATTAGAAGCAAGAATGG - Intronic
995243706 5:109913860-109913882 TTGTTAATTAGATGCCATCATGG - Intergenic
996843265 5:127871721-127871743 ATGAGAATTAGAAATAACCAGGG - Intergenic
997783064 5:136679257-136679279 CTGTGAGTGAGAAGAAACCATGG - Intergenic
998237272 5:140408979-140409001 CTGTGCATTAGAAGCATCCCTGG + Intronic
998449919 5:142226263-142226285 GAGTGAATTATAAGGAACCAGGG + Intergenic
998960292 5:147479289-147479311 TTGTGGAGTAGACACAACCAGGG - Intronic
1000450200 5:161376326-161376348 GTTTGAATTAGAATCAACCATGG + Intronic
1000784402 5:165526277-165526299 TTTTGAAGTAGAAGTAACAAGGG - Intergenic
1001765526 5:174242915-174242937 TTGAGAAACAGAAGCAAACATGG - Intronic
1004772682 6:18801867-18801889 TTGTGAATTAGAAGTAAAATTGG + Intergenic
1004948501 6:20642156-20642178 ATGTGTATTAGAAGAAAACATGG + Intronic
1006671016 6:35729692-35729714 TTTTGAAATAAAAGCAACAAAGG - Intergenic
1006967113 6:37999008-37999030 TTCTCCAATAGAAGCAACCAGGG + Intronic
1007455416 6:41973525-41973547 TTGAATATTAAAAGCAACCATGG + Intronic
1008184572 6:48372997-48373019 GTGTTAATTAGAAGCCAACATGG + Intergenic
1008310620 6:49967560-49967582 TTCTGACTTAGAAGAAATCAAGG - Intergenic
1008748617 6:54704903-54704925 GTGTGAAGAAGAAGCAACCCAGG + Intergenic
1009797569 6:68491608-68491630 TTTTGAACTAAAAGGAACCAGGG - Intergenic
1010543683 6:77124055-77124077 TTGTCACTCAGAAGAAACCACGG - Intergenic
1010807183 6:80251094-80251116 TTGTGAATAAAAGGAAACCAGGG - Intronic
1012103702 6:95125420-95125442 TTGCAAATTAGAATCACCCAAGG - Intergenic
1015728681 6:136325584-136325606 TTGAGAATTGGAAGCAATTAAGG - Intergenic
1016884915 6:148950197-148950219 TTCTGAATTAGAAGGAACTCTGG - Intronic
1020598330 7:10240541-10240563 TTTTGAATAAGAAGCAGCTAGGG + Intergenic
1021558210 7:21943313-21943335 TTATGAGTAAGAAGCAAACAAGG - Intronic
1023531541 7:41161701-41161723 GTGTGAATTAGAATCACCTATGG + Intergenic
1026970895 7:74466883-74466905 AAGTGAATTAGAAGCAAGCTCGG + Intronic
1030020358 7:105269279-105269301 TAGTGAAATAGAAACAGCCAAGG - Intronic
1030923144 7:115417749-115417771 TTGTGAACTACAAGCAAAAAAGG - Intergenic
1031269036 7:119621375-119621397 CTCTGAATTAGCAGGAACCATGG - Intergenic
1033120369 7:138662733-138662755 TTGGGACTTAGAAGCAGTCATGG - Intronic
1033509080 7:142036557-142036579 TTTTAAATAAGAAGCAAACAAGG + Intronic
1038461841 8:27723681-27723703 TTGTGAACTTTGAGCAACCATGG + Intergenic
1039098919 8:33919696-33919718 TTCTTCATTAAAAGCAACCAGGG + Intergenic
1039633319 8:39135951-39135973 CTGAAAATAAGAAGCAACCAGGG - Intronic
1039990061 8:42479902-42479924 TTGTGAATGAGGAGCACTCAGGG + Intronic
1046465229 8:114593188-114593210 TTGTGAATTAGAAAAAATCCTGG + Intergenic
1046509634 8:115185677-115185699 TTGTGAATTTTATGCAACAAGGG + Intergenic
1047583793 8:126246398-126246420 TTTTCCAATAGAAGCAACCAAGG - Intergenic
1050782460 9:9354769-9354791 TTCTCAATGAGAAGCACCCATGG - Intronic
1051983521 9:23053983-23054005 TTATGAAATAGAAGCAACCTAGG + Intergenic
1053657616 9:40234760-40234782 TTGTTTTTTAGAAGAAACCATGG + Intronic
1054369740 9:64381031-64381053 TTGTTTTTTAGAAGAAACCATGG + Intronic
1054526980 9:66141468-66141490 TTGTTTTTTAGAAGAAACCATGG - Intronic
1054677367 9:67870784-67870806 TTGTTTTTTAGAAGAAACCATGG + Intronic
1057395503 9:94676404-94676426 GTGAGACTTAGAAGCCACCAAGG + Intergenic
1058713405 9:107701243-107701265 TTTTGAACTAAAAGGAACCAGGG - Intergenic
1059378524 9:113905493-113905515 TTGTGGAATGGAAGCAGCCACGG - Intronic
1186232086 X:7466341-7466363 TGGTGCATTAGTAGCACCCAAGG - Intergenic
1186917825 X:14242943-14242965 TTGTAAAGTAGAAGCAAAAATGG - Intergenic
1187322816 X:18256118-18256140 TTATGGAAGAGAAGCAACCATGG + Intronic
1187931269 X:24295560-24295582 CTGTGAGTTAGAAGCAGCAACGG + Intergenic
1189080867 X:37971283-37971305 TTGTGTATTAAAAGCAACTCAGG + Intronic
1189460174 X:41235103-41235125 TTGTAACTTCAAAGCAACCAAGG - Exonic
1190539311 X:51460763-51460785 TTATGGATAAGAAGCAAGCATGG + Intergenic
1191908083 X:66117028-66117050 TCTAGCATTAGAAGCAACCATGG - Intergenic
1192057708 X:67788995-67789017 TTGTGATTTAGAAGGAAGCTGGG + Intergenic
1195446863 X:104962141-104962163 TAGTGAATTAGGAGAAAGCAAGG - Intronic
1197590819 X:128407905-128407927 TTGTGCATTTCAAGCAATCAAGG - Intergenic
1198012488 X:132572474-132572496 CTGTGAATCAGGAGCAACCAAGG + Intergenic
1198128016 X:133666452-133666474 TTGTGAAGTAGATGCAAAAATGG - Intronic
1198752456 X:139949313-139949335 CTAAGAATTAGAAGCAACAAAGG - Intergenic
1199837326 X:151604828-151604850 ATATGCATTAGAATCAACCAGGG + Intronic