ID: 1108618755

View in Genome Browser
Species Human (GRCh38)
Location 13:52160473-52160495
Sequence ATATATATAAAGGAGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 438
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 403}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108618750_1108618755 13 Left 1108618750 13:52160437-52160459 CCAAAAAAAAAAAAAAATATATA 0: 36
1: 111
2: 912
3: 21195
4: 38808
Right 1108618755 13:52160473-52160495 ATATATATAAAGGAGGAGGTGGG 0: 1
1: 0
2: 3
3: 31
4: 403
1108618749_1108618755 20 Left 1108618749 13:52160430-52160452 CCTGTCTCCAAAAAAAAAAAAAA 0: 1057
1: 15552
2: 22473
3: 44095
4: 105224
Right 1108618755 13:52160473-52160495 ATATATATAAAGGAGGAGGTGGG 0: 1
1: 0
2: 3
3: 31
4: 403

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108618755 Original CRISPR ATATATATAAAGGAGGAGGT GGG Intergenic
901716190 1:11156504-11156526 AGATAGGTAAAGGAGAAGGTAGG - Intronic
901952149 1:12757898-12757920 AATTAGATAAAGGAGGCGGTTGG - Intronic
902535223 1:17115864-17115886 ATACATAGAAAGAAGGAAGTAGG - Intronic
903467584 1:23562727-23562749 ATATAGATAAAGGAAGAAGGTGG - Intergenic
904494907 1:30881061-30881083 ATATATATGCATGAGGATGTTGG - Intronic
904632553 1:31853566-31853588 ATATATATAAAGGATGAGAAAGG + Intergenic
906321798 1:44822027-44822049 ATATAAATAATGGATGTGGTAGG + Exonic
906729891 1:48071996-48072018 AAATATAAAAAGGATGAGGTGGG - Intergenic
907237644 1:53062758-53062780 ATCTATAAAGAGGTGGAGGTTGG - Intronic
909138627 1:71834412-71834434 AGAGATATAAAGGTGGAGGAAGG + Intronic
909330943 1:74409787-74409809 ATAAATATAAAAGAAAAGGTGGG - Intronic
909483128 1:76146909-76146931 AGAGATGTCAAGGAGGAGGTCGG - Intronic
909751639 1:79168545-79168567 ATATATAGAAAGCATGAAGTAGG + Intergenic
909754512 1:79207233-79207255 ATATAAATAAATTAGAAGGTTGG - Intergenic
909850453 1:80455436-80455458 AAATAGTTAAAGGAGAAGGTGGG + Intergenic
910145381 1:84074453-84074475 ATATATATATAGTAGGACGAGGG - Intergenic
910801334 1:91149658-91149680 ATATATGAATAGGAGGGGGTTGG - Intergenic
911665257 1:100543987-100544009 ATTTATATAAAACAAGAGGTTGG + Intergenic
912235175 1:107843555-107843577 ATATATATATATGAGGAAGGTGG + Intronic
912261434 1:108114687-108114709 TTTTGTATAAAGTAGGAGGTGGG - Intergenic
912730679 1:112100354-112100376 ATATATATGAAGAGGGGGGTGGG - Intergenic
914443441 1:147727514-147727536 ATATAGAAAAGGGAGGAAGTTGG + Intergenic
914889313 1:151608706-151608728 ATATTTAGAAAGGATCAGGTTGG - Intergenic
916319556 1:163488514-163488536 ATATATATATATGAGATGGTGGG + Intergenic
917050944 1:170922523-170922545 ATAGATATAAAGAAGAAGATAGG + Intergenic
917202202 1:172529722-172529744 ATATATATAAAGAAGATGATCGG + Intergenic
917231282 1:172840612-172840634 ATATATAAGACGGAGGAGGAGGG - Intergenic
918067758 1:181113061-181113083 ATATAAATAAAGGGGGAGCCAGG - Intergenic
918484147 1:185011649-185011671 ATCTCTATAAAGAAGGAGGTTGG - Intergenic
918832710 1:189418604-189418626 ATGAATTTAGAGGAGGAGGTTGG - Intergenic
918867188 1:189917198-189917220 ACAGATATTAATGAGGAGGTGGG - Intergenic
920877103 1:209846681-209846703 GCATATATAAGGGAGGAGGAAGG + Intronic
921096961 1:211895047-211895069 AGATATTTAAGGAAGGAGGTAGG - Intergenic
921677120 1:217988910-217988932 ATATCTAGTAAGGAGGGGGTTGG + Intergenic
923611529 1:235499903-235499925 TTATATAGAAAGGAGGTGGTGGG + Intronic
924189491 1:241535274-241535296 GTTTATGGAAAGGAGGAGGTAGG - Intronic
924402353 1:243699452-243699474 ATATATATAGTGGAAGAGGTTGG - Intronic
1064866741 10:19889193-19889215 ATATATATAAAATGGGATGTTGG - Intronic
1064887473 10:20126963-20126985 ATATATATAAAACACTAGGTTGG + Intronic
1065992230 10:31023047-31023069 ATTTATATAAAGTATTAGGTTGG - Intronic
1066079167 10:31912500-31912522 ATAAGTATGAAGGAGGAGTTAGG + Intronic
1066628880 10:37438886-37438908 ATATATATATTGGTAGAGGTGGG + Intergenic
1067107944 10:43377982-43378004 ATACATGTGAAGGTGGAGGTGGG - Intergenic
1068557448 10:58474874-58474896 ATATATATAAAGCAAATGGTAGG - Intergenic
1069896216 10:71681793-71681815 AAATAAATAAAGGAGAAGGGAGG + Intronic
1070000360 10:72371757-72371779 ATATATATATAGGCCAAGGTGGG + Intronic
1070027447 10:72645606-72645628 AAATAAATAAAGGAGCAGGGTGG + Intergenic
1071154034 10:82669164-82669186 ATAAATATGAAGGAGCAGTTAGG + Intronic
1071249283 10:83800467-83800489 ATACATCTAAAGGAAGAGATAGG - Intergenic
1071467977 10:85958150-85958172 ATATTTACAAAGGAGCATGTGGG - Intronic
1071787268 10:88915846-88915868 GAATACATAAAGGAGGAGGTTGG + Intronic
1072595984 10:96872394-96872416 TTACAAATAAAGGAGGAGGCTGG + Intronic
1073170446 10:101502719-101502741 ATCTAAATGAACGAGGAGGTGGG - Intronic
1073194755 10:101681041-101681063 AAATTTATAAAGGTAGAGGTGGG + Intronic
1073770053 10:106726100-106726122 ATAAACAGAGAGGAGGAGGTTGG - Intronic
1075853504 10:125608166-125608188 ATAAAGAGAAAGGAGGATGTGGG + Intronic
1076257187 10:129036993-129037015 ATATATAGAAAGAGAGAGGTAGG + Intergenic
1076870878 10:133193528-133193550 AAATAAATAAAGGAGGAAGAAGG + Intronic
1077580359 11:3413551-3413573 ATCTATAAAATGGAGGTGGTGGG - Intergenic
1078009095 11:7557104-7557126 AAAAATATAAAAGAGGAGTTAGG - Intronic
1078574919 11:12492576-12492598 TTAAAGATAAAGGAGGTGGTAGG + Intronic
1078641134 11:13097918-13097940 ATATATAACAAGGATGCGGTGGG + Intergenic
1078688108 11:13551529-13551551 AGGTAGATAAAAGAGGAGGTTGG + Intergenic
1078693216 11:13602803-13602825 AATTAGATGAAGGAGGAGGTTGG - Intergenic
1079162439 11:18007706-18007728 ATTTGTATAATGGAGGGGGTGGG + Intronic
1080111486 11:28572981-28573003 AGAAAGATAAAGAAGGAGGTGGG + Intergenic
1081485988 11:43529601-43529623 AAAGATATAGAAGAGGAGGTGGG - Intergenic
1081578092 11:44332255-44332277 AGAGACATGAAGGAGGAGGTGGG - Intergenic
1081729205 11:45357063-45357085 ATAGATATAAAGTATGAGATGGG + Intergenic
1082220590 11:49631004-49631026 ATATATTTAACCAAGGAGGTAGG - Intergenic
1082630725 11:55538937-55538959 ATAAATATAAAGAAAGAAGTGGG + Intergenic
1082730937 11:56796782-56796804 TTATTTATAAAGGACGAGGGTGG - Intergenic
1082948308 11:58784380-58784402 ATATATATTAATGAGGATATTGG - Intergenic
1085918914 11:80927719-80927741 TTATTTATAAGGGATGAGGTAGG - Intergenic
1086160990 11:83721809-83721831 ATATAAATAAAGAAGGTGGCTGG + Intronic
1086867621 11:91999058-91999080 ATATAGAGAAGGGAGGAGGAGGG + Intergenic
1087734123 11:101812396-101812418 ATATTTAAAATGGAGGAGTTGGG + Intronic
1088313097 11:108480785-108480807 ATATATGTAAAGTGGGAGTTGGG - Intronic
1088424648 11:109689780-109689802 TTTTATATATAGTAGGAGGTAGG - Intergenic
1089086761 11:115826346-115826368 ATATTTAGAAAGGAGGAGCAGGG - Intergenic
1090560714 11:127929221-127929243 AAATATTTTATGGAGGAGGTAGG + Intergenic
1091390590 12:123854-123876 ATTTATAAAAATGGGGAGGTTGG + Intronic
1092180468 12:6443305-6443327 ATATGTAGAAAAGAGGAGATGGG + Intergenic
1092407952 12:8233972-8233994 ATCTATAAAATGGAGGTGGTGGG - Intergenic
1093373967 12:18400852-18400874 ATATATATAAAGAAAGAGGTAGG - Intronic
1093547279 12:20363657-20363679 ATATATAAAAAGTAGCAGTTTGG + Intergenic
1093674952 12:21927817-21927839 ATCTATTTACAGGAGGTGGTAGG - Intronic
1093722546 12:22461727-22461749 ATTTATATAAAGGATGAAGAGGG + Intronic
1093796707 12:23321686-23321708 AATTTTATAAAGGAGGTGGTTGG - Intergenic
1094731310 12:33179501-33179523 ATAGACAGAAAGGATGAGGTTGG + Intergenic
1096187560 12:49591807-49591829 TAATATATACAGGAGGATGTGGG - Intronic
1097161774 12:57051294-57051316 ATATATTTGAAGGTGGAGGGGGG + Intergenic
1098009774 12:66038245-66038267 ATTTAAATAAAGGAAGAGTTTGG + Intergenic
1098033745 12:66281301-66281323 ACATCCATAAATGAGGAGGTTGG - Intergenic
1098191672 12:67955674-67955696 ATGGATATAAAGGAAGAGGAAGG - Intergenic
1098323016 12:69268313-69268335 ATATATATAAAAGAGAAGTCTGG + Intronic
1098740958 12:74172603-74172625 ATATATAAAAGGGAGGGGGTGGG - Intergenic
1098766188 12:74492254-74492276 ATAAATATAAACAAGGAGGGAGG + Intergenic
1101048867 12:100840043-100840065 ATATGTATGAGAGAGGAGGTGGG - Intronic
1101627045 12:106454826-106454848 ATATAGAAACAGGAGGTGGTTGG + Intronic
1102310443 12:111840913-111840935 AAGTATAAAAAGGATGAGGTTGG - Intergenic
1102840804 12:116119010-116119032 CTACATATAAATGGGGAGGTGGG + Intronic
1105266704 13:18825273-18825295 ATCTATATAAAGGAGGTTGGTGG + Intergenic
1107275646 13:38675926-38675948 ATGGATATAAAGGAAGAGGAAGG + Intergenic
1107594617 13:41950178-41950200 ATATGTATAAAGGAGAAGTGAGG + Intronic
1108618755 13:52160473-52160495 ATATATATAAAGGAGGAGGTGGG + Intergenic
1109283205 13:60380729-60380751 ATATAAACAAAGCAGGAGGTGGG - Intergenic
1109749165 13:66666906-66666928 TTAAATATAAAAGAGGAGGAGGG - Intronic
1111058377 13:82980023-82980045 AGTTAAATAAAGGAGGTGGTTGG - Intergenic
1112983561 13:105418125-105418147 AAATATACAAAGGATGAGGAAGG - Intergenic
1114005267 14:18306262-18306284 ATATATATAAAAGAAAAGATTGG - Intergenic
1114256831 14:21010379-21010401 ATTTAAAGAAAGGAGGAGGCTGG + Intergenic
1114259279 14:21025525-21025547 AGATTAAGAAAGGAGGAGGTGGG + Intronic
1114741524 14:25103278-25103300 ATATATATAAGGAAGGAGGAAGG + Intergenic
1115353627 14:32423923-32423945 TTATATTTAATGGAGTAGGTAGG + Intronic
1116190797 14:41662911-41662933 ATAAATGTAAAGAAGGTGGTTGG - Intronic
1116662045 14:47722742-47722764 ATATATATAAAGTAGGGGCCAGG - Intergenic
1117525787 14:56602261-56602283 ATAAATAGAAAGGAGCAGGGAGG + Intronic
1117975311 14:61291227-61291249 ATATATATAAATTAGAAAGTTGG + Intronic
1117993575 14:61458290-61458312 ATAAATAGAAAGGATGAGTTTGG + Intronic
1118522620 14:66602780-66602802 ATATATATTAAGGAGGGGGGTGG + Intronic
1118615250 14:67570718-67570740 AAAAATAAAAAGGAGGAGGTAGG - Intronic
1118831059 14:69433283-69433305 ATATATAATAACTAGGAGGTGGG - Intronic
1119154841 14:72400416-72400438 ATCTATAAAAATCAGGAGGTGGG - Intronic
1120197474 14:81500754-81500776 AGATATAAAAAGGAGGAGCAAGG + Intronic
1120683485 14:87509613-87509635 ATATATGTATATGAGGAGGAAGG - Intergenic
1120747088 14:88162141-88162163 ATAAAAAAAAGGGAGGAGGTTGG + Intergenic
1121435489 14:93916426-93916448 ATATAGATAAAGGAGAAGACTGG - Intergenic
1121548388 14:94779740-94779762 AAATAGATAAAGGAGGAGTTAGG + Intergenic
1122158874 14:99768526-99768548 ATATAGCAAAGGGAGGAGGTGGG + Intronic
1123137305 14:106040103-106040125 CTATATATAAAGGGGTAGGCTGG + Intergenic
1202876452 14_KI270722v1_random:6743-6765 ATAAAAAAAAAGAAGGAGGTTGG - Intergenic
1124454961 15:29833810-29833832 AAAAATATAAATGAGGAGGTTGG - Intronic
1124946940 15:34277438-34277460 ATATATATATAGTGGGGGGTTGG - Intronic
1125289823 15:38133672-38133694 ATATATAAAAAGGGGGTAGTAGG - Intergenic
1125734819 15:41917413-41917435 ATATAAATAAATAAGGAGGCCGG - Intronic
1127363618 15:58266872-58266894 ATATTTATATAGGAGGAGAGCGG - Intronic
1130037651 15:80376390-80376412 CTATATATAAATTAGGAGGGTGG - Exonic
1130160965 15:81399636-81399658 ATATTTATAAGGCAGGAGCTTGG - Intergenic
1130557250 15:84931248-84931270 AAAAATAAAAAGGAGGAGGGAGG - Intronic
1131025984 15:89141912-89141934 ATATTTTTAAAGGTAGAGGTTGG + Intronic
1131837752 15:96408184-96408206 ATAAGAATAAAGAAGGAGGTGGG - Intergenic
1131837804 15:96408510-96408532 GTTTATTTAAAGAAGGAGGTGGG - Intergenic
1132204539 15:99977339-99977361 ATATATATATATGAAGAGGAGGG - Intronic
1133889558 16:9866437-9866459 AAATATATAAAGGAGAAGAGAGG + Intronic
1134449211 16:14353716-14353738 ACATATATACAGGGGAAGGTGGG + Intergenic
1135114951 16:19716547-19716569 ATATATATGGATGAGGAGTTTGG + Intronic
1135140233 16:19915030-19915052 AGAAATAAAAAGAAGGAGGTTGG - Intergenic
1135911843 16:26568431-26568453 ATATATATATAGAGGGAAGTGGG + Intergenic
1136007907 16:27343722-27343744 ATTAAGATAAAGGAGGAGGCCGG - Intronic
1136170223 16:28484819-28484841 ATATATATACAGGAGGAATATGG - Intronic
1136644051 16:31593350-31593372 ATTTATTAAAAAGAGGAGGTAGG - Intergenic
1137482439 16:48863839-48863861 ATAAAGATCAAGGAGGAGGCCGG - Intergenic
1138514821 16:57530284-57530306 ATTTATTTTAAGGAGGAGGGGGG - Intronic
1139440087 16:66962226-66962248 AGCTGTATAAAGGAGGTGGTTGG + Intronic
1139819757 16:69711989-69712011 ATTTCTATAAAGAGGGAGGTTGG - Intronic
1141561677 16:84872558-84872580 ATATGTTTAAAGCAGGTGGTTGG + Intronic
1141581388 16:85001930-85001952 ATATATATACAAGATGAGCTTGG + Intronic
1142712630 17:1731611-1731633 ATATATATAAAGGCCGAGCGTGG + Intronic
1143484274 17:7244498-7244520 ATCTCAAGAAAGGAGGAGGTGGG - Intronic
1143636557 17:8167167-8167189 ATAAATAAAAAGGAAGATGTGGG - Intergenic
1144144427 17:12383653-12383675 TTATAAATAAAGGAGGTGCTGGG + Intergenic
1144298229 17:13899514-13899536 AGCTCTATAAAGGAGGTGGTTGG - Intergenic
1145830342 17:27911150-27911172 ATCTAAATAAAGAAGGAGCTGGG - Intergenic
1145849000 17:28072588-28072610 AAATATATAAATAAGGTGGTAGG - Intronic
1145908459 17:28529014-28529036 ATGTATATAAATGGGGAGGAGGG + Intronic
1146144061 17:30395171-30395193 ATATATATAAATGAACAGATGGG + Intronic
1146245445 17:31277865-31277887 TTATGTATAAAGGAGAAGGCAGG - Intronic
1147742085 17:42675511-42675533 ATAAATATAGAGGAGGGGGGAGG - Intronic
1148033406 17:44638957-44638979 ATATATATAAAGAGAGAGGCTGG + Intergenic
1150075971 17:62192342-62192364 ATAAAAAGAAAGCAGGAGGTGGG - Intergenic
1150739814 17:67770176-67770198 AAAAATAAAAAGGAGGAGGCCGG - Intergenic
1151558119 17:74857122-74857144 ATATTTAGAAAAAAGGAGGTTGG - Intronic
1153093513 18:1374678-1374700 AATTAGATAAAGGAGGTGGTTGG + Intergenic
1153231466 18:2940840-2940862 AAATATATGAAGGAGAAGGGGGG + Intronic
1153396510 18:4627760-4627782 ATATATTTAAAAGAGCAAGTAGG - Intergenic
1154134744 18:11766430-11766452 AAAGATATAAAGGAGCAGGGAGG + Intronic
1154421711 18:14236198-14236220 ATCTATATAAAGGAGGTTGGTGG - Intergenic
1155805159 18:30160986-30161008 AAACATTTAAAGGAGGAGATAGG - Intergenic
1157127919 18:44974677-44974699 ATATATTTAAAAGAGGAGAAAGG + Intronic
1157892666 18:51432872-51432894 ATATTTTTAAAGGACAAGGTGGG + Intergenic
1158223602 18:55177056-55177078 ATATATATAAATGAAGATGAAGG + Intergenic
1159038735 18:63302688-63302710 ATATAAATAAATGAGAAAGTAGG + Intronic
1163953957 19:20616854-20616876 ATATATAAAAAATAGGAGATTGG + Intronic
925961435 2:9020872-9020894 ATAGATATAGAGGAGAAGGAGGG - Intergenic
926017326 2:9465586-9465608 AAATATATAAAAGAGGAAATTGG + Intronic
926783013 2:16492756-16492778 GTATATTTGAAGGAGGAGGGTGG + Intergenic
930979802 2:57510100-57510122 ATATGTGTAAAGAAGGAGGATGG + Intergenic
932948842 2:76269487-76269509 AGATATAGAAGGGAGGGGGTGGG - Intergenic
933518998 2:83347455-83347477 ATATAAATAAAAGAGCAGGAGGG + Intergenic
939857561 2:147378309-147378331 ATATATGTAAAATAGGAGCTGGG + Intergenic
940213236 2:151277581-151277603 ATAGATATAAATGAGGATTTGGG - Intronic
941557303 2:166997405-166997427 AAATGTTTAAATGAGGAGGTAGG + Intronic
943052566 2:182933979-182934001 ATATATATAAAACAGCAGGTTGG - Intronic
944218210 2:197276745-197276767 AAATATATAAAAGAGGATGCTGG + Intronic
944391038 2:199219939-199219961 ATAAATATAAAGCAGAATGTGGG - Intergenic
944435869 2:199688874-199688896 ATAGAAATAATGGAGGATGTAGG - Intergenic
944725105 2:202463099-202463121 ATATTTATAAATGAAGAGATTGG - Intronic
945914929 2:215693534-215693556 ATACAGAAAAAGGAGCAGGTGGG + Intergenic
946623337 2:221583026-221583048 ATTTATATAAAGGAGGGGGAAGG + Intergenic
946639473 2:221767848-221767870 ACATTTATAAAGGAGGGGTTAGG + Intergenic
946685848 2:222268918-222268940 ATATACATAAAGGAGTAGGAGGG - Intronic
946764732 2:223030082-223030104 ATACAGAGAAAGCAGGAGGTAGG + Intergenic
946891403 2:224280888-224280910 ATCTATATAAAGGTGAAGGGAGG - Intergenic
946902178 2:224383345-224383367 AGAAATATGGAGGAGGAGGTCGG - Intronic
947256196 2:228166596-228166618 ACATATATAAAGAATGAGGCAGG - Intronic
947275348 2:228385574-228385596 ATCTATATAAGGGATGATGTTGG + Intergenic
1169071961 20:2738297-2738319 AGAGATTTAAAGGAGAAGGTGGG - Intronic
1170374579 20:15686487-15686509 ATATATATAAAGCAGTAGAAGGG + Intronic
1172136037 20:32687496-32687518 ATTTAAAAAAAGGAGGTGGTGGG + Intergenic
1172473282 20:35217101-35217123 ATGTATATGAGTGAGGAGGTTGG - Intergenic
1173269809 20:41522955-41522977 ATATATATGCAGGAGTGGGTAGG + Intronic
1174009216 20:47436133-47436155 ATAAAAATAAAGGGGAAGGTGGG - Intergenic
1174440672 20:50550064-50550086 ATATATATAGAAGGGGGGGTGGG - Intronic
1174966311 20:55220155-55220177 ATAAATATAAATAAGTAGGTAGG - Intergenic
1175023052 20:55872024-55872046 ATATATATAAAGGAGAAGTGGGG + Intergenic
1176366819 21:6038219-6038241 ATAGAAATAAAAGAGGAGGGCGG - Intergenic
1176851773 21:13923762-13923784 ATGTATATAAAGGAGGTTGGTGG + Intergenic
1177089155 21:16744394-16744416 ATATATATTCAGGATGAGGAAGG - Intergenic
1177881124 21:26696210-26696232 AAATATATAAAGTAGGAAGATGG - Intergenic
1178039953 21:28629252-28629274 GTAATTAGAAAGGAGGAGGTGGG + Intergenic
1178208056 21:30493164-30493186 ATATATTGAAAAGAGGAGGCCGG - Intergenic
1178449454 21:32682174-32682196 ATATATATAAGGGAAGAACTAGG + Intronic
1179756699 21:43500325-43500347 ATAGAAATAAAAGAGGAGGGCGG + Intergenic
1180429778 22:15237054-15237076 ATATATATAAAAGAAAAGATTGG - Intergenic
1180857116 22:19055184-19055206 ATATATATAAACCATGAGGATGG + Intronic
1182610930 22:31546819-31546841 ATATATATATATGATGATGTTGG - Intronic
1182970362 22:34568081-34568103 ATAAATCTAAAGAAGGAGATAGG + Intergenic
1183881919 22:40839852-40839874 ATATATATAAAAAAAGAGGCTGG + Intronic
1184543389 22:45146108-45146130 ATATATATAAAGGACATGTTGGG - Intergenic
949311202 3:2700319-2700341 ATATATTTAGAGGAAGAGATGGG + Intronic
949461618 3:4300999-4301021 ATATATATATTGGTGGAGGGTGG - Intronic
949807704 3:7973882-7973904 ATTTATTTAAGGGAGGAGGAAGG + Intergenic
950847771 3:16031461-16031483 CTTAATAAAAAGGAGGAGGTAGG + Intergenic
952458169 3:33494193-33494215 ATATTTTTAAAGGAGAAGGGAGG + Intergenic
952529454 3:34248376-34248398 ATAGATAGAAAGCAGGGGGTGGG + Intergenic
952894204 3:38065870-38065892 ATTTTTAAAAAGCAGGAGGTGGG - Intronic
955402590 3:58603848-58603870 ATCTGTAAAAAGCAGGAGGTTGG - Intronic
956636487 3:71370452-71370474 ATATTTCTAAAGGAGGAGTTGGG - Intronic
957053229 3:75426148-75426170 ATCTATAAAATGGAGGTGGTGGG - Intergenic
957430783 3:80103447-80103469 ATGTTTTTAAAGGAGAAGGTAGG - Intergenic
957478646 3:80760745-80760767 AAATCTATAAAGAAGGAAGTAGG - Intergenic
957832713 3:85544280-85544302 TTATATAAAAAAGAGGAGGCCGG + Intronic
958187822 3:90145995-90146017 GTCTATATAAAGGAGTAGATGGG - Intergenic
959890293 3:111547315-111547337 ATATATAAAAAGAAGGAGCAGGG - Intronic
960325531 3:116291141-116291163 ATATATTCAAAGGAGTAAGTAGG - Intronic
960427846 3:117531061-117531083 ATAAATATAAATGAAGAGGAGGG - Intergenic
961301597 3:125925396-125925418 ATCTATAAAATGGAGGTGGTGGG + Intergenic
961584830 3:127913812-127913834 ATAAAAAAAAAGGAAGAGGTGGG + Intergenic
961654708 3:128434920-128434942 ATTTATATAAAGGAAAAAGTTGG + Intergenic
961699078 3:128727438-128727460 ATAGAAAGAAAGGAGGTGGTGGG - Intronic
961886870 3:130102459-130102481 ATCTATAAAATGGAGGTGGTGGG - Intronic
962207441 3:133446632-133446654 ATATATATAAAGGAGTTTCTTGG + Intronic
962604791 3:137024185-137024207 ATAAATAAAAAGAAGGAGGAAGG - Intergenic
962823042 3:139071333-139071355 ATAGAGATAAGTGAGGAGGTGGG - Intronic
963194004 3:142506221-142506243 ATGTATCTAAAGGAGAAGGTAGG + Intronic
964423276 3:156527325-156527347 ATATATATAAAGCAAAAAGTAGG + Intronic
964449319 3:156795443-156795465 ATATATGTAAATGAGAAGATAGG + Intergenic
965307558 3:167085522-167085544 ATAATAATAAAGGAGGAGGGAGG + Intergenic
965375629 3:167920066-167920088 ATAAATATAAAAGAGGGAGTGGG - Intergenic
965448912 3:168812518-168812540 ACATATGTAAAGGAGTAGTTTGG - Intergenic
966012099 3:175091817-175091839 AGATATATAAAAGAGAAGTTTGG - Intronic
966141423 3:176761125-176761147 ATATATATATAGGAATTGGTAGG + Intergenic
966141454 3:176761775-176761797 ATATATATATAGGAATTGGTAGG - Intergenic
967033960 3:185633470-185633492 ATATATATAAGGAAGGGGTTTGG + Exonic
967408443 3:189142892-189142914 AAATATATTAATGAGGTGGTGGG - Intronic
968118005 3:196104472-196104494 ACATTTATCATGGAGGAGGTGGG + Intergenic
968643527 4:1727144-1727166 ATAAAAATAAAGGAAGTGGTGGG + Intronic
968852571 4:3093655-3093677 ATATATAAAAAGGAGGCAGAGGG + Intronic
968996035 4:3946464-3946486 ATCTATAAAATGGAGGTGGTGGG - Intergenic
969757951 4:9162235-9162257 ATCTATAAAATGGAGGTGGTGGG + Intergenic
969969851 4:11034376-11034398 AAATATATAAAGGAGGAGACAGG - Intergenic
971797337 4:31244604-31244626 ATGTAGACAAAGGGGGAGGTGGG + Intergenic
971965000 4:33542394-33542416 ATTTATACAAAGAAGGGGGTAGG - Intergenic
972002113 4:34050598-34050620 ATGTATATAAAGGAAGAGCAAGG + Intergenic
972028152 4:34413278-34413300 CTATCTATTAAGGAGAAGGTTGG - Intergenic
973566567 4:52194696-52194718 ATAAATAAAAAGGAAGATGTAGG - Intergenic
973776124 4:54243560-54243582 CTAAAGTTAAAGGAGGAGGTTGG + Intronic
973940248 4:55901472-55901494 ATATATATAAAAGAAGACCTGGG + Intronic
974876454 4:67709227-67709249 TTACATATAAAGGAAGAGATAGG - Intergenic
975224362 4:71853951-71853973 ACATATTTAAAGAAGGAAGTTGG - Intergenic
975642845 4:76517633-76517655 ATATATATAAAGGGGATGTTAGG + Intronic
975780503 4:77834394-77834416 ATATATATAAAGAAGAAACTAGG + Intergenic
976599739 4:86927219-86927241 ATATATCAAAAGGTGGAGGCCGG + Intronic
977099762 4:92795900-92795922 ATATAAATAAAAAAGGAGGGAGG - Intronic
977796570 4:101172824-101172846 ATATATTTAAGTGAGGACGTGGG - Intronic
978423173 4:108555610-108555632 TTTCATATTAAGGAGGAGGTTGG + Intergenic
979736458 4:124091849-124091871 ATATATTACAATGAGGAGGTTGG + Intergenic
980164041 4:129202973-129202995 ATATATATAAAAGAAGAGTGAGG + Intergenic
980265466 4:130508623-130508645 AAAAATATAAAGGTGGAGGAAGG + Intergenic
981268083 4:142811172-142811194 ATATATGCACAGGTGGAGGTAGG - Intronic
981628468 4:146788964-146788986 AGATATCTAAAGGAGGTGATGGG + Intronic
981892359 4:149753569-149753591 AAAGATATAAAGGAGGGTGTGGG + Intergenic
983741545 4:171140410-171140432 CTTTATATAAAGGAGGGGATTGG + Intergenic
983868169 4:172792845-172792867 ATATAGATAAAGAGGGAGGAAGG - Intronic
984724851 4:183010927-183010949 GTATATAGAAAGGAGATGGTGGG - Intergenic
984944926 4:184963234-184963256 TTATTTACAAAGGAGGAGGCTGG - Intergenic
986371769 5:7087500-7087522 ATATATATAAAATAGGTGGAGGG - Intergenic
986865590 5:11982555-11982577 ATATATTTAGGGGTGGAGGTGGG + Intergenic
987170609 5:15253509-15253531 ATATAGACAAAGTAGGAGATGGG + Intergenic
987246634 5:16055492-16055514 ATATATATATAGTTGGAGGTGGG - Intergenic
987445666 5:18016169-18016191 ATGTGTATCAAGGAGGAGATTGG + Intergenic
987829208 5:23074319-23074341 ATATATATATATGTAGAGGTGGG - Intergenic
989404151 5:41041661-41041683 GTATATATAAATGTGGAGGAAGG - Intronic
989445607 5:41524966-41524988 AAATAACAAAAGGAGGAGGTCGG - Intergenic
990090740 5:52044349-52044371 ATATATATAATGGGGGAGAAAGG - Intronic
991098532 5:62765432-62765454 ATACATAAAAGGGAGGTGGTAGG + Intergenic
992196436 5:74344026-74344048 AACCATATAAAGGAAGAGGTTGG - Intergenic
993326151 5:86539481-86539503 ATAAATATAAAAGATAAGGTAGG + Intergenic
993826436 5:92692920-92692942 TTATATAGAAAGGAAGAGGAGGG + Intergenic
993869129 5:93229846-93229868 ATATAATAAAAGGAGGAGGAAGG + Intergenic
994042346 5:95273446-95273468 ATAGTTATAATGAAGGAGGTTGG - Intronic
994722204 5:103393188-103393210 ATAGATAAAAAGGTGGGGGTGGG + Intergenic
995219415 5:109631066-109631088 AAATATATAAGGGAGGGGGGAGG - Intergenic
995264968 5:110148594-110148616 ATATATATAAAAGGTGAGGTTGG + Intergenic
995594336 5:113731652-113731674 ATATTTATAATCCAGGAGGTGGG - Intergenic
995739132 5:115336136-115336158 CTATATTTAAAGGAGGTGGGGGG - Intergenic
996182720 5:120439414-120439436 ATAACTATGTAGGAGGAGGTTGG + Intergenic
996593738 5:125178064-125178086 ATATATATAAATGTGGATATCGG - Intergenic
996836713 5:127801701-127801723 ATGTATCTAAAGGAGGCTGTGGG - Intergenic
996855505 5:128001649-128001671 AAAAATAAAAAGGAGGAGGAAGG + Intergenic
997593513 5:135091042-135091064 ATGTATATAGAGGAGGAGGTAGG + Intronic
998349324 5:141490744-141490766 ACATACACAAAGGAGGAGGCTGG - Exonic
1000200266 5:159002665-159002687 ATATATATAGAAAAGGAGGAAGG + Intronic
1001079411 5:168656115-168656137 AAAAATAAAAAGGAGGAGGAGGG - Intergenic
1001233419 5:170009487-170009509 ATATTTATAAAGGAGGATTCAGG - Intronic
1002553017 5:180011474-180011496 ATATATACAAAGGTTGAGGGTGG + Intronic
1003454077 6:6264545-6264567 ATATAGATAAAGAAGGAAATAGG - Intronic
1003485682 6:6576450-6576472 ATATTAATCCAGGAGGAGGTGGG + Intergenic
1004008634 6:11659694-11659716 ATATATAAAATGGTAGAGGTAGG - Intergenic
1004149859 6:13106072-13106094 ATATAGTTAAAGGAGGAAGTAGG + Intronic
1004173575 6:13318750-13318772 ATATAAATAAAGAAGGAGAAGGG + Intronic
1004226933 6:13794082-13794104 ACACATATAAAGAAGCAGGTAGG - Intronic
1004260087 6:14100501-14100523 ATACATATAAAGGAAGAAGTAGG + Intergenic
1004780752 6:18905860-18905882 CTATTTATAAAGATGGAGGTAGG - Intergenic
1005042610 6:21612790-21612812 CTGTATCTAAAGGAGGAGGCTGG - Intergenic
1005579879 6:27223567-27223589 ATATATATAGAGAGAGAGGTGGG - Intergenic
1007313648 6:40966792-40966814 ATATATATGAAGGAGGGGTCAGG + Intergenic
1008398715 6:51038857-51038879 ATATATATGAATGAAGTGGTAGG + Intergenic
1008489231 6:52068058-52068080 AGATATGGAAAGGAGGAGGAAGG + Intronic
1008501176 6:52184868-52184890 ATACAGATGGAGGAGGAGGTAGG - Intergenic
1008515471 6:52314695-52314717 ATAGATGGAAAGGAGGAGGCTGG + Intergenic
1008954169 6:57197225-57197247 ATATATATAATAGAGGGGTTGGG + Intronic
1009321226 6:62291700-62291722 ATACACATAAAGGAGGTGGGAGG + Intergenic
1009618398 6:66039989-66040011 TCATAGATAAAGGAGGAGGTAGG - Intergenic
1010996783 6:82542762-82542784 ATATAAATAAATGAGGAAGAAGG + Intergenic
1011835474 6:91425892-91425914 ATATAACTAAAAAAGGAGGTGGG - Intergenic
1013564993 6:111349502-111349524 AAATATAGAAAGAAGGAGGGAGG - Intronic
1013792273 6:113851136-113851158 ATACATAAAGAGGAGGAGGGAGG - Intergenic
1014105265 6:117553805-117553827 TGATACATAAAAGAGGAGGTGGG - Intronic
1014126004 6:117777689-117777711 AAATATAGAAAGGAGGAGAGTGG - Intergenic
1014260445 6:119210442-119210464 ATATATTTAAAGCAGCATGTAGG - Intronic
1014965828 6:127748988-127749010 ATATCTATAAATGAGGGAGTGGG + Intronic
1016788036 6:148035042-148035064 ATATATATAAAGGAAGGAGGAGG - Intergenic
1017436856 6:154423934-154423956 ATATATATAAAGGGATAGGCCGG + Intronic
1017593715 6:156006007-156006029 AGAGAGATAAAGGAGGAGGAGGG + Intergenic
1018306716 6:162464898-162464920 ATATTTATTAAGAAGGAGGAGGG - Intronic
1018633454 6:165840204-165840226 ATGTAGATAAGGGTGGAGGTGGG - Intronic
1020075823 7:5258190-5258212 ATAAAAATAAAAAAGGAGGTGGG + Intergenic
1020518549 7:9156716-9156738 ATATACAGATAGGAGGTGGTGGG - Intergenic
1021205808 7:17779324-17779346 ATATATATTAAAGAGTAGGAGGG + Intergenic
1021227358 7:18043662-18043684 ATATATATAAATGAGGGGTATGG + Intergenic
1021422046 7:20456474-20456496 ATATATAAAAAAAAAGAGGTCGG - Intergenic
1022199747 7:28104645-28104667 AAATAAATAAAGTAGGAGGGAGG - Intronic
1023164195 7:37326804-37326826 GAATATCTAAAGGAGAAGGTAGG - Intronic
1023238232 7:38113766-38113788 GTATAAGTAAGGGAGGAGGTAGG - Intergenic
1024718600 7:52108536-52108558 ATATATATAAAGGCTGTGATGGG - Intergenic
1024945288 7:54801895-54801917 ATTTATATACAGGAGGTGGATGG - Intergenic
1025156383 7:56610577-56610599 AAATATTTAAAAGAAGAGGTTGG - Intergenic
1025203256 7:56975372-56975394 ATAAAAATAAAAAAGGAGGTGGG - Intergenic
1025668688 7:63601555-63601577 ATAAAAATAAAAAAGGAGGTGGG + Intergenic
1026468173 7:70672263-70672285 ATGTCTAGAAAGGAGGAAGTGGG - Intronic
1027560453 7:79722121-79722143 ATAAATATAAAGGAGGTGAGGGG - Intergenic
1027618453 7:80452707-80452729 ATTTATATAAAGCACAAGGTAGG - Intronic
1027670395 7:81089682-81089704 ATAAATAGAAAAGAGGAGATAGG + Intergenic
1028357552 7:89927425-89927447 ATAAATAGAAAGGAGAAAGTAGG + Intergenic
1028765704 7:94556632-94556654 AAATATTTAAAATAGGAGGTGGG - Exonic
1030105133 7:105981031-105981053 ATTTATGTGAAGGATGAGGTTGG + Exonic
1031685436 7:124728157-124728179 ATATATATAAAGGAAAAAGCTGG + Intergenic
1031873656 7:127113879-127113901 TTAGATATAAATGAGGAGTTAGG + Intronic
1033111340 7:138580474-138580496 ATAGATGTCATGGAGGAGGTGGG + Intronic
1033707686 7:143904818-143904840 ATTAATATAAAGGAGGAGAGTGG - Intergenic
1033829338 7:145233540-145233562 AGATATCTAAAGGAGGTGATGGG - Intergenic
1034362916 7:150516816-150516838 ATTTATATGAATGGGGAGGTTGG + Intronic
1034398748 7:150847556-150847578 CTATATACAAAGGTGGAGCTAGG - Intronic
1034916294 7:155042604-155042626 ATTTAAATAAAGGAGCAGTTAGG - Intergenic
1035004813 7:155648207-155648229 AAATATACAAAAGTGGAGGTGGG - Intronic
1036082237 8:5569425-5569447 ATAAATATATAGAAGGAGGTAGG + Intergenic
1037035843 8:14165627-14165649 ATATAAATAGAAGAGGAGGAAGG - Intronic
1038223099 8:25629301-25629323 ATATATACAAAAGAGGAGTGGGG + Intergenic
1038349702 8:26764618-26764640 ATATAAAGAAAAGAGGAGGTGGG - Intronic
1039302013 8:36219952-36219974 AGTTACATAAAGGAGGAGGTTGG - Intergenic
1041986556 8:63928626-63928648 ACATATGTATAGGAGGAGATAGG + Intergenic
1042445933 8:68885050-68885072 CTATATATACAGGATGGGGTAGG + Intergenic
1043885832 8:85599612-85599634 ATATCTATAAATGAGGATGCTGG + Intergenic
1044014327 8:87032040-87032062 AGATATATAAAGGAAGGGTTAGG - Intronic
1044955336 8:97474378-97474400 AAATATAAAAAGGAGGAGGGTGG - Intergenic
1045142050 8:99297010-99297032 ATATATATATATGAGGGGGAGGG + Intronic
1046204512 8:110975307-110975329 AGAAAGATAAAGGAGGGGGTGGG + Intergenic
1046399230 8:113682213-113682235 ATTTTTTTAAAGGAGGAGGTGGG + Intergenic
1050100562 9:2114857-2114879 ATCTATATAAAGAAAAAGGTAGG - Intronic
1051011262 9:12417074-12417096 ATGTATATAAAGTAGGAGACTGG - Intergenic
1051812753 9:21068780-21068802 GTATGTATAAAGAAGGAAGTGGG - Intergenic
1051839324 9:21376666-21376688 AAAAAAATAAAGGAGGAGATGGG - Intergenic
1052377859 9:27738256-27738278 AAATAAATAAATGAGGAGGAGGG - Intergenic
1052521830 9:29557940-29557962 ATATATTTAAAGAACAAGGTAGG - Intergenic
1052524984 9:29605376-29605398 TTATAAAAAAATGAGGAGGTGGG - Intergenic
1052814995 9:33095652-33095674 ATATATATAAAATAAAAGGTTGG + Intergenic
1054937955 9:70709507-70709529 ATAGTAATAAAGGAGGCGGTTGG - Intronic
1054939646 9:70727500-70727522 ATAGTAATAAAGGAGGCGGTTGG - Intronic
1055331951 9:75194045-75194067 AGAGATAGAAAGGAGGAGGAAGG - Intergenic
1055849243 9:80605762-80605784 AAAAATGAAAAGGAGGAGGTTGG - Intergenic
1055918110 9:81427726-81427748 ATATGTATACTGAAGGAGGTTGG + Intergenic
1055984700 9:82045441-82045463 TTATAAATGAAAGAGGAGGTCGG - Intergenic
1058244686 9:102607847-102607869 ATATAAATAAAGCAGGTGGCTGG - Intergenic
1059561301 9:115337246-115337268 ACATAAATAAAGGAAGTGGTAGG - Intronic
1060768079 9:126309809-126309831 ATGTATATAGAGCAGGAGGGGGG + Intergenic
1060848830 9:126858732-126858754 AAATATATAAATGATGAGTTTGG + Intergenic
1203652040 Un_KI270751v1:134584-134606 ATAAAAAAAAAGAAGGAGGTTGG + Intergenic
1186147850 X:6643632-6643654 CTATATTTGAATGAGGAGGTGGG - Intergenic
1186168509 X:6852840-6852862 ATGGATACAAAGGATGAGGTTGG + Intergenic
1187049999 X:15686357-15686379 TTGTTTAAAAAGGAGGAGGTGGG + Intergenic
1188114104 X:26222966-26222988 ATATATATAAAGAAGTGGGGAGG - Intergenic
1189635606 X:43005131-43005153 ATGTGTACAAAGGAGGGGGTAGG + Intergenic
1190421309 X:50287344-50287366 GTATATATAAAGGAGGGGCCGGG - Intronic
1190449508 X:50564248-50564270 ATATATGTCCAGGAGGTGGTTGG + Intergenic
1191766707 X:64705792-64705814 AGAGATCTAAAGGAGGAGTTTGG + Intergenic
1192387640 X:70688815-70688837 ATATATATAATTTGGGAGGTTGG + Intronic
1193757912 X:85431310-85431332 ATAAATATAAAGGAGGAGATAGG + Intergenic
1194624340 X:96211314-96211336 ATAGATGTTAAGGAGGGGGTAGG - Intergenic
1194741138 X:97575600-97575622 ATATATAAAAAGGAGGGAATAGG + Intronic
1195593722 X:106663280-106663302 ATATTTATATGTGAGGAGGTAGG - Intronic
1196501751 X:116391983-116392005 ATATATATAAAAGAAAAGTTGGG + Intergenic
1196988277 X:121298983-121299005 TGATCTATAAAGGAGGAGGTTGG + Intergenic
1197832491 X:130659227-130659249 ATGAATAAAAAGGAGGATGTTGG - Intronic
1199261121 X:145776595-145776617 ATATCTATAGAAGAGAAGGTGGG - Intergenic
1200363731 X:155638281-155638303 ATATATATATTAGAGGAGGCAGG - Intronic
1201524016 Y:14911097-14911119 ATATATAAAAATCAGGTGGTAGG - Intergenic