ID: 1108623520

View in Genome Browser
Species Human (GRCh38)
Location 13:52206170-52206192
Sequence TTCCCACAGCCCCAAGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108623508_1108623520 27 Left 1108623508 13:52206120-52206142 CCCTTCTTTTTTTCAGGTGTGGG No data
Right 1108623520 13:52206170-52206192 TTCCCACAGCCCCAAGGGGATGG No data
1108623510_1108623520 26 Left 1108623510 13:52206121-52206143 CCTTCTTTTTTTCAGGTGTGGGT No data
Right 1108623520 13:52206170-52206192 TTCCCACAGCCCCAAGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108623520 Original CRISPR TTCCCACAGCCCCAAGGGGA TGG Intergenic
No off target data available for this crispr