ID: 1108640900

View in Genome Browser
Species Human (GRCh38)
Location 13:52381412-52381434
Sequence CAGGTGTTTTAGGGGACCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 121}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108640900 Original CRISPR CAGGTGTTTTAGGGGACCCA TGG (reversed) Intronic
900940725 1:5796934-5796956 CAGGTTTTCTAGGAGACACAAGG + Intergenic
901327499 1:8376862-8376884 CAGGTGTTGGAGGGATCCCAGGG + Intronic
903238171 1:21964227-21964249 CAGGAGTTTGTGGGGAGCCAGGG - Intergenic
903853137 1:26320324-26320346 CAGCTGTTTCAGGGGGCACAGGG - Exonic
904624079 1:31792460-31792482 CAGGGGTTTCAGGGAGCCCAGGG - Intronic
905866558 1:41380048-41380070 CAGGTCTGTTGGGGGACCGAAGG + Intronic
910535939 1:88297617-88297639 CAGGGGCTTTATGGGACCCTGGG + Intergenic
920441974 1:205986786-205986808 CAGTTTATTTAGGGGAGCCAAGG + Intronic
920573542 1:207037109-207037131 GAGCTGTTTTAGGGGAGTCAAGG - Intronic
921446402 1:215251940-215251962 CAGGTCCTTTAGGAGACCAATGG - Intergenic
921997022 1:221431509-221431531 CTGCTGTTTTAGAGGACCCATGG - Intergenic
922216189 1:223522236-223522258 AGGGTGTTCTGGGGGACCCAGGG - Intergenic
923033319 1:230266747-230266769 CTGGAGATTTAGGGGAACCAGGG - Intronic
923187574 1:231588877-231588899 CAGATGTTGTAGGGGACACAGGG - Intronic
1067479393 10:46585248-46585270 AAGGTGTTTAAGGGGCCCCAGGG + Intronic
1067615345 10:47756550-47756572 AAGGTGTTTAAGGGGCCCCAGGG - Intergenic
1068159006 10:53239611-53239633 GAGGTGTTTTATGGGAGACAGGG - Intergenic
1070360505 10:75684000-75684022 CATGTTTTTAAGGGGACCCTTGG + Intronic
1071431058 10:85607393-85607415 CAGGTGCTAAATGGGACCCAAGG + Intronic
1071630747 10:87216501-87216523 AAGGTGTTTAAGGGGCCCCAGGG - Intergenic
1072110563 10:92316038-92316060 CAAGTGTCTTTGGGGACCAATGG - Intronic
1072623947 10:97099004-97099026 CAGGGATGTTAGGGGACCAAGGG + Intronic
1074759310 10:116654548-116654570 CAGCTGCTTTAAGGGAACCAAGG + Intergenic
1080508111 11:32938220-32938242 CAGGTTTTTGAGAGGACTCAGGG + Intronic
1083791732 11:64990098-64990120 TAGGTGGTTTGGGGGACACACGG - Intronic
1084166909 11:67379414-67379436 CAGGTGTGGGTGGGGACCCAGGG - Intronic
1087646595 11:100815012-100815034 CACTTGTTTTAGAGGGCCCAAGG - Intronic
1091457545 12:618958-618980 CTGTTGTTTGTGGGGACCCATGG - Intronic
1093022141 12:14213697-14213719 AATGTGTATCAGGGGACCCAGGG + Intergenic
1093946958 12:25120267-25120289 CAGGTGTGTTAGGGGAGAGAGGG + Intronic
1096237509 12:49939769-49939791 CTGGAGTCCTAGGGGACCCAGGG + Intergenic
1097008870 12:55938484-55938506 GGGGTGTTTTAGGGGGGCCAGGG - Intronic
1104090302 12:125511355-125511377 AAGGTGTTTCATGGAACCCAAGG + Intronic
1108640900 13:52381412-52381434 CAGGTGTTTTAGGGGACCCATGG - Intronic
1110434406 13:75463359-75463381 CCAGTGCATTAGGGGACCCAAGG - Intronic
1113637343 13:111928800-111928822 CAGGTGGTTCAGAAGACCCAAGG - Intergenic
1119019474 14:71095965-71095987 CAGGTGTTTGAGGTCACCCTGGG + Intronic
1120998930 14:90437456-90437478 CATGTGTCTTTGGGGGCCCAGGG - Intergenic
1121416846 14:93785411-93785433 CTGGTGCTTTGGGGGACCCCAGG + Intronic
1123097078 14:105771869-105771891 CAGGAGCTTCAGGGGACTCAGGG - Intergenic
1123508571 15:20971972-20971994 GAGGTGTTTTCTGGTACCCAGGG + Intergenic
1124942064 15:34227709-34227731 AATCTGTTTGAGGGGACCCAAGG - Exonic
1126518176 15:49558266-49558288 CAGGTGTTTAGGTGGATCCAGGG - Intronic
1129737202 15:77973052-77973074 CAGGTGCTTTAAGGGACCCTGGG + Intergenic
1129848876 15:78780583-78780605 CAGGTGCTTTAAGGGACCCTGGG - Intronic
1130253076 15:82313497-82313519 CAGGTGCTTTATGGGACCTTGGG + Intergenic
1132750861 16:1457034-1457056 CACGTGTGGCAGGGGACCCAAGG + Intronic
1134531019 16:14983952-14983974 CAGGAGTTTGAGGGCAGCCAGGG + Intronic
1139865331 16:70057077-70057099 CAGGAGTTTGAGGGCAGCCAGGG - Intergenic
1141485289 16:84334779-84334801 CAGGTGTTTGAAGGGACTTAGGG - Intergenic
1141997938 16:87647121-87647143 CTGGGGTTTTGGGGGGCCCAGGG + Intronic
1142474757 17:182154-182176 CAGGTGATCAAGGGCACCCAGGG + Intergenic
1146845954 17:36182318-36182340 CAGGTGATCCAGGGCACCCAGGG - Intronic
1147615315 17:41823890-41823912 CACGTCTCTTAGGGGACCCTGGG - Intergenic
1148569759 17:48658885-48658907 CAGGTCTGTTGGGGGTCCCATGG + Intergenic
1149849157 17:60025254-60025276 CAGGTGATCAAGGGCACCCAGGG - Intergenic
1149861011 17:60121270-60121292 CAGGTGATCAAGGGCACCCAGGG + Intergenic
1152764412 17:82128264-82128286 CATGTGCTTTAGGGGTCCCGGGG + Intronic
1152815654 17:82406151-82406173 CTGGTGTTTTTGTGGGCCCAGGG - Intronic
1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG + Intronic
1157197657 18:45632510-45632532 CAAGTGTCTTGGGGGCCCCATGG - Intronic
1157572756 18:48723834-48723856 CATGTGTTTTGGGGAAGCCAAGG + Intronic
1160886388 19:1350938-1350960 CTGGTGTTTCTGGAGACCCAGGG - Intergenic
1161335943 19:3713312-3713334 CATGGGTTTTGGGGGACCCTGGG - Intronic
1165413596 19:35677637-35677659 CGGGTGGTTTCGGGGCCCCAGGG - Intronic
1166497080 19:43311312-43311334 CAGGTGTTTTAGCCGACTAATGG + Intergenic
1167493517 19:49805337-49805359 CAGGTCTTTGAGGGACCCCATGG - Intronic
1168405437 19:56108050-56108072 CACGTGTTGCAGGGGACCCGAGG - Intronic
925209955 2:2036986-2037008 CAGGTGTATTGGGAGAACCAAGG - Intronic
925221303 2:2143640-2143662 CAGGTGTTAGAGGGGACAGAAGG + Intronic
930623400 2:53668164-53668186 CAGGGGATTTTGGGGACTCAGGG + Intronic
931838739 2:66127256-66127278 CAGGTGTTTGAGGTCATCCAGGG - Intergenic
931859973 2:66344796-66344818 TAGGATTTTTAGGGGAACCATGG - Intergenic
933219780 2:79675645-79675667 GAGGTGCTTTTGGGGATCCATGG + Intronic
937733383 2:125260996-125261018 CAAGTGTGTTAGGGGATCCCAGG + Intergenic
937986351 2:127639886-127639908 CAGGGGGTCTAGGGGATCCAGGG - Intronic
940588587 2:155689173-155689195 GAGGTGCTTTAGGGGACCAGTGG - Intergenic
941313581 2:163964887-163964909 CAGGCGTTTTAGGGGGAACACGG + Intergenic
942576092 2:177364652-177364674 CGGGTGCTTCAGGGCACCCAGGG - Intronic
943276589 2:185875889-185875911 CAACTGTTTTAGGAGCCCCAGGG - Intergenic
946104688 2:217358808-217358830 CAGGTGATTCAGGGGGTCCATGG + Intronic
946171263 2:217897295-217897317 CATGTGTCTTAAGGGACCCTGGG - Intronic
946701213 2:222416215-222416237 CAAGTGATTTTGGGGCCCCAAGG - Intergenic
946830865 2:223726798-223726820 CAGGTATGTCAGGGCACCCACGG + Intergenic
947228654 2:227863737-227863759 CAGGTTCTTTAAGGGACCCAGGG + Intergenic
947307943 2:228767822-228767844 CAGTTGTTTTAAGGGCACCATGG + Intergenic
1170676691 20:18488472-18488494 CAGGTGTTTGAGGCCAGCCAGGG - Exonic
1174131200 20:48344436-48344458 CAAGTGTTGTGGGGGCCCCAGGG - Intergenic
1176020157 20:62958653-62958675 CAGAGGTTCTAGGGGAGCCATGG - Intronic
1182679736 22:32069470-32069492 CAGGTGTTTGAGGCCACCCTGGG + Intronic
1183317821 22:37146531-37146553 CAGGATCTGTAGGGGACCCAGGG - Intronic
1184802675 22:46771244-46771266 CAAGTGTTTTTGAGGAACCATGG + Intronic
950025981 3:9820244-9820266 CAGGTGTGTTAGAGGTCCCAGGG + Intronic
961565295 3:127759384-127759406 CAGGTGTGGTAGGGGACCAAGGG - Intronic
962928862 3:140019432-140019454 CAGGTGATTATGGTGACCCAGGG - Intronic
963578983 3:147100090-147100112 TAGGTGTTTTAGTGGAGACAGGG - Intergenic
966986020 3:185181056-185181078 CAGGGGCTTCAGTGGACCCATGG - Intergenic
968585087 4:1412624-1412646 CAGGTGTCTCTGGGGGCCCAGGG - Intergenic
968903310 4:3440951-3440973 GAGGGGTTTTAGGGGATACAGGG + Intergenic
971516337 4:27491457-27491479 CAGGTGTTTTTGGGAAGCAATGG + Intergenic
974485953 4:62506228-62506250 CAGGTTGTTTAGGGGGCCGAAGG + Intergenic
980073809 4:128271754-128271776 CAGCTGTTCCAAGGGACCCAGGG + Intronic
981802786 4:148677631-148677653 CAGGTGTGGCAGGTGACCCACGG + Intergenic
988186488 5:27870904-27870926 CAGGTGGTTTGCGTGACCCATGG + Intergenic
992905508 5:81341714-81341736 GAGGTTTTTTAGGAGACCCTCGG - Intronic
996074040 5:119168760-119168782 CAGGTGTTTGAGATGAGCCAGGG - Intronic
996303621 5:122020380-122020402 CAGGTGTCTTCTGGGACTCAAGG - Exonic
998847469 5:146325005-146325027 CAGGTGTTTTAGGAGGCAGAGGG - Intronic
1001836076 5:174833789-174833811 CAGTTGGTTTAAGGGCCCCATGG + Intergenic
1005602633 6:27443315-27443337 CAGGTGTCTTAGAGGAGCTAGGG - Intergenic
1006131201 6:31870533-31870555 CAGGAGTGCTAGGGGACCTAGGG - Intronic
1006807470 6:36797976-36797998 CAGGTATTTCAGGGGAACCCAGG - Intronic
1007647223 6:43392239-43392261 CAAGCGTGTTAGGGGACCCCAGG - Intergenic
1008585349 6:52943513-52943535 CAGGTGTTTGAGGCCACCCTGGG + Intergenic
1010407473 6:75521326-75521348 AAGTTGTGTTAGGGGAACCATGG - Intergenic
1013883536 6:114933942-114933964 CAGGTGTGCTGGGGGACCCAAGG + Intergenic
1014526288 6:122505642-122505664 CAGGTTTTTAAAGGGACTCAGGG - Intronic
1015561966 6:134525615-134525637 CAGTTGTTACAGGGCACCCAAGG + Intergenic
1015989940 6:138929273-138929295 CAGGTGTTTTAGGGGAGGCAGGG + Intronic
1018279471 6:162170086-162170108 CAGCTGTTATAGGAAACCCAGGG - Intronic
1022103289 7:27181835-27181857 CCGGTGTTTTGGGGGACTCAAGG + Exonic
1023513218 7:40975334-40975356 CAGCTGTGATATGGGACCCAAGG - Intergenic
1028532498 7:91852765-91852787 CAGGTGTTTTCAGGGGGCCAAGG - Intronic
1029848918 7:103442639-103442661 AGGGTGTTTTATGGGACCAATGG - Intronic
1037058631 8:14478518-14478540 CAGGTGTTATGGGGGACAGAGGG + Intronic
1039208449 8:35183969-35183991 CATTTAATTTAGGGGACCCATGG + Intergenic
1044370940 8:91409942-91409964 CAGTTATTTAAGGGGACACAGGG + Intergenic
1047720564 8:127635139-127635161 AAAGTGTTTTAGAGGATCCAGGG - Intergenic
1049306876 8:141908650-141908672 CAGGTGTTTAATGGGGCCCATGG - Intergenic
1050880620 9:10695605-10695627 CAGTTGTTTAAAGTGACCCAGGG + Intergenic
1051356115 9:16240858-16240880 CAGCTATGTTAGGGGCCCCATGG + Intronic
1055573452 9:77640174-77640196 CAGTTGGGTTAGGGGACTCAAGG - Intronic
1056616215 9:88168244-88168266 CAGGAGTTTGAGGGGAGCCTGGG + Intergenic
1187299177 X:18031363-18031385 CTGGTGTTTTAGGGAACTCCAGG + Intergenic
1187775781 X:22755113-22755135 GAAGTGTTTTATAGGACCCAGGG - Intergenic
1190227694 X:48559022-48559044 CAGGTGTTTTCAGGGACCCTAGG + Exonic
1191627025 X:63280649-63280671 CATGTGTTTTTGGGGTTCCATGG - Intergenic
1195747719 X:108135480-108135502 CTGGATTTTTTGGGGACCCAAGG + Intronic