ID: 1108642704

View in Genome Browser
Species Human (GRCh38)
Location 13:52397395-52397417
Sequence GGTCCTCTTCCCAGGGTATC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 242}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108642698_1108642704 9 Left 1108642698 13:52397363-52397385 CCCAGGGGCAGGCTGTTTTCAGC 0: 1
1: 0
2: 3
3: 25
4: 178
Right 1108642704 13:52397395-52397417 GGTCCTCTTCCCAGGGTATCTGG 0: 1
1: 0
2: 2
3: 35
4: 242
1108642699_1108642704 8 Left 1108642699 13:52397364-52397386 CCAGGGGCAGGCTGTTTTCAGCC 0: 1
1: 0
2: 4
3: 23
4: 213
Right 1108642704 13:52397395-52397417 GGTCCTCTTCCCAGGGTATCTGG 0: 1
1: 0
2: 2
3: 35
4: 242
1108642696_1108642704 19 Left 1108642696 13:52397353-52397375 CCTCCTCTCTCCCAGGGGCAGGC 0: 1
1: 1
2: 10
3: 60
4: 480
Right 1108642704 13:52397395-52397417 GGTCCTCTTCCCAGGGTATCTGG 0: 1
1: 0
2: 2
3: 35
4: 242
1108642697_1108642704 16 Left 1108642697 13:52397356-52397378 CCTCTCTCCCAGGGGCAGGCTGT 0: 1
1: 0
2: 3
3: 34
4: 369
Right 1108642704 13:52397395-52397417 GGTCCTCTTCCCAGGGTATCTGG 0: 1
1: 0
2: 2
3: 35
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108642704 Original CRISPR GGTCCTCTTCCCAGGGTATC TGG Exonic
900024491 1:258832-258854 GGTGCTCTTCCGAGGATATCTGG + Intergenic
900028099 1:348237-348259 GGTGCTCTTCCGAGGATATCTGG + Intergenic
900032931 1:384365-384387 AGTCATCTTCCCAAGGTGTCAGG - Intergenic
900053772 1:614255-614277 AGTCATCTTCCCAAGGTGTCAGG - Intergenic
902092543 1:13914942-13914964 GGTCCCCTGCTCAGGGTCTCAGG - Intergenic
902528410 1:17074733-17074755 GCTCCACTTCCCTGGGTGTCTGG - Intronic
902533032 1:17102720-17102742 GGTCCCCTTCCCAGGCTCTGTGG - Intronic
907474069 1:54693752-54693774 GGTGCTTTCCCCAGGGTCTCAGG + Intronic
912711595 1:111953925-111953947 GGTCGGCTTCCCAGGGTTTGGGG - Intronic
913094349 1:115502395-115502417 GCACCTCTTCACAGGGTAGCAGG - Intergenic
913445367 1:118944896-118944918 ACTCCTCTTCCCAGGGAATGGGG + Intronic
914705410 1:150166127-150166149 GGTCCTCTTAGCAGGGTATGTGG - Intergenic
916502511 1:165399074-165399096 GTTGCTCTTCCTAGGGTATAAGG + Intergenic
917976120 1:180239741-180239763 TGTCCGCTTCACAGGGTGTCTGG + Intronic
920365975 1:205448620-205448642 GGTCCTCACTCCAGGGTATGAGG + Intronic
922195041 1:223352554-223352576 GGTACTCTTGGCAGGCTATCAGG + Intronic
922553254 1:226512910-226512932 GAGCCACTTCCCAGGTTATCAGG + Intergenic
924956817 1:248936753-248936775 GGTGCTCTTCCGAGGATATCTGG - Intergenic
1062878939 10:962940-962962 AGCCCTCTGCCCAGGGTCTCGGG - Intergenic
1063387479 10:5625099-5625121 GGTGCTCTTCCGAGGATAGCTGG - Intergenic
1065233603 10:23623941-23623963 TATCCTTTTCCCAGGGTATAAGG - Intergenic
1067497310 10:46773007-46773029 TGGCCTCTTCCCAGGGTGACTGG + Intergenic
1067597342 10:47567408-47567430 TGGCCTCTTCCCAGGGTGACTGG - Intergenic
1067972208 10:50985720-50985742 GGTCCTCTTCCCAGCTCATGTGG + Intergenic
1068742527 10:60490305-60490327 GGGCCTCATCCCAGAGTTTCTGG - Intronic
1070140691 10:73735018-73735040 TGGCCTCTTCCCAGGGTGACTGG - Intergenic
1070686862 10:78491349-78491371 GGTCCTTTTCCCAGGGTAATAGG - Intergenic
1071214079 10:83378550-83378572 GGCCCTCTTGCCAGGGTCTAAGG - Intergenic
1071252785 10:83838089-83838111 GGACATCTTCCCAGGGTCTGAGG + Intergenic
1071273839 10:84034712-84034734 GGTCTTCTTTCCAGGGGACCTGG - Intergenic
1072626701 10:97116754-97116776 GGTCCTCACCCCAGAGCATCTGG + Intronic
1073129409 10:101177388-101177410 GGTGTTCTGCCCAGGGTATTGGG - Intergenic
1075601364 10:123771861-123771883 GCACCTCTTCACAGGGCATCAGG - Intronic
1076348258 10:129795451-129795473 CGTCCTCTTCCCCTGGTAGCAGG + Intergenic
1076463090 10:130659712-130659734 GTTCCTGTTCCCTGGGTCTCGGG - Intergenic
1076916445 10:133424859-133424881 GGCCCTCATCCCAGGGCACCAGG - Intergenic
1076936550 10:133569654-133569676 GGCCCTCATCCCAGGGCACCAGG - Intronic
1076962710 10:133778414-133778436 GGTGCTCTTCCGAGGATATCTGG - Intergenic
1077343917 11:2037742-2037764 GGTGCTCTTCACAGGGGACCCGG + Intergenic
1079248160 11:18768506-18768528 GGTCCCCTTCCAGAGGTATCTGG - Intronic
1080326341 11:31078006-31078028 AGTCCTCCTGCCAGGCTATCTGG - Intronic
1083348766 11:62012574-62012596 GTTCCTCATCCCAGGGCCTCTGG + Intergenic
1084919149 11:72454964-72454986 AGTCCTCCTCCCAGGGAATGAGG - Intergenic
1086837009 11:91637449-91637471 GCACCTCTTCCCAGGGCAGCAGG - Intergenic
1089085494 11:115813619-115813641 GCTCCTCTTCACAGGGCAGCAGG + Intergenic
1202826903 11_KI270721v1_random:92931-92953 GGTGCTCTTCACAGGGGACCCGG + Intergenic
1096216906 12:49802926-49802948 GGGCTTCTCCCCAGGGTGTCTGG + Intronic
1096520666 12:52182837-52182859 GGTCCTCTCCCCTGGGGCTCAGG - Intronic
1097288066 12:57892841-57892863 AGTCCTCTTCTCTGTGTATCTGG - Intergenic
1101339611 12:103831276-103831298 GCACCTCTTCACAGGGCATCAGG - Intronic
1104130005 12:125884383-125884405 GGACCTCTTCCCAGGGTGGCAGG - Intergenic
1104742143 12:131185418-131185440 GCACCTCTTCACAGGGTAGCAGG + Intergenic
1107381625 13:39862869-39862891 GGAGCTATTCCCAGGGTTTCTGG - Intergenic
1107525117 13:41222762-41222784 GGTCCTCTTCCAAGTTTATGTGG - Intronic
1108642704 13:52397395-52397417 GGTCCTCTTCCCAGGGTATCTGG + Exonic
1112066218 13:95795934-95795956 GGTCCTCTTCCCAGAGCCTCAGG + Intergenic
1113533795 13:111048525-111048547 GATCCTCTTTCCAGGTTTTCAGG - Intergenic
1113989208 13:114346340-114346362 GGTGCTCTTCTGAGGATATCTGG - Intergenic
1115301008 14:31885201-31885223 GCTCCTCTTCACAGGGCAACAGG - Intergenic
1115508872 14:34120286-34120308 GGTCCCCTTCCTGGGGCATCTGG + Intronic
1118867812 14:69717265-69717287 GCTCCTCTTCACAGGGTAGCAGG + Intergenic
1119718551 14:76875620-76875642 TGTTCTCTTCCCATGGAATCAGG - Intergenic
1120316714 14:82903631-82903653 GCTCCTCTTCACAGGGCAGCAGG - Intergenic
1122071124 14:99205977-99205999 GGTCCTCTGTTGAGGGTATCGGG - Intronic
1122397642 14:101444973-101444995 GGTCCTCTTCCCGGAGTGCCAGG - Intergenic
1123178857 14:106447918-106447940 GGACCTCTGCCCAGGGAAGCCGG - Intergenic
1124411837 15:29443391-29443413 GGGCCTCTTCCCTGGATTTCTGG - Intronic
1124593823 15:31077521-31077543 GGTCTGCTTCCCAGGGTTTGTGG + Intronic
1127900718 15:63338992-63339014 TAGCCTCTTCCCAGGGGATCAGG - Intronic
1129544086 15:76376151-76376173 GGGCCTCTTACCTGGTTATCTGG + Exonic
1135885810 16:26306462-26306484 GCCCCTCTTCCCATGCTATCAGG + Intergenic
1137669725 16:50272099-50272121 TTGCCTCCTCCCAGGGTATCAGG + Intronic
1138483713 16:57321522-57321544 GGTGCTCTTCTGAGGATATCTGG - Intergenic
1138563784 16:57817727-57817749 GGTCATATTCCCAGGGTTCCAGG + Intronic
1139074475 16:63427340-63427362 GGTCCTCTTCCATGAGGATCTGG - Intergenic
1139967727 16:70755012-70755034 GGTTTTCTTCCCAGGGTACTGGG - Intronic
1141519263 16:84566782-84566804 GGTCCTCTCCCCCGGGGAGCAGG + Exonic
1141696845 16:85624254-85624276 GTTCCTCTGCCCAGGGCCTCTGG + Intronic
1142067463 16:88071138-88071160 GCTCCTCTTCCCAGGGCCACCGG + Intronic
1142623199 17:1177980-1178002 GGACCTATGCCCAGGGGATCCGG + Intronic
1142743816 17:1945107-1945129 GGAGCGCTTCCCAGGGTGTCTGG + Intronic
1145249601 17:21289926-21289948 GGTCCCCTGCCCAGGGTGGCCGG + Intronic
1145347348 17:22049390-22049412 GGTCCAGTTCCCAGGGATTCTGG - Intergenic
1145416238 17:22715943-22715965 GGTCCAGTTCCCAGGGATTCTGG + Intergenic
1146272477 17:31493420-31493442 GGTTCCCTTTCCATGGTATCAGG - Intronic
1146805657 17:35863247-35863269 GCTCATCTTCCCAGGATACCAGG + Intronic
1147170740 17:38617353-38617375 TGTCCTCTTCCCAGAGCAGCGGG + Intergenic
1147554256 17:41466297-41466319 GGTCCTCTTCCCTGGAACTCTGG + Intronic
1148689780 17:49520540-49520562 TGCCCTCTTCCCACAGTATCCGG + Intergenic
1148830463 17:50427482-50427504 GGTCCTCTTCCCAGTGACCCTGG + Intronic
1149392978 17:56210752-56210774 GCACCTCTTCACAGGGTAGCAGG + Intronic
1151177654 17:72301942-72301964 GGTCCTCTGCCCCTGGTCTCTGG + Intergenic
1151198010 17:72445635-72445657 GGTCAACTTCCCAGGGTATCTGG + Intergenic
1152688912 17:81708589-81708611 GGTCCTCTTCCAAGGCCTTCTGG + Intergenic
1152951821 17:83240095-83240117 GGTACTCTTCCGAGGATATCTGG - Intergenic
1154274341 18:12947096-12947118 AGGCCTCTTCCCAGGGGCTCTGG + Intergenic
1154505680 18:15038658-15038680 GCACCTCTTCACAGGGTTTCGGG + Intergenic
1156589405 18:38468997-38469019 CGTCCTCATCCTGGGGTATCTGG - Intergenic
1157937627 18:51890896-51890918 GGCCCTCTTCCCAGGCTGTGGGG + Intergenic
1158238437 18:55347630-55347652 GGTCTTCCTCCCAGGCAATCAGG - Intronic
1158510412 18:58085358-58085380 GGTCCTCTACCCAGCGTAGGGGG + Intronic
1160282576 18:77506247-77506269 GGACCTCTTCACAGGGTGGCAGG + Intergenic
1162054197 19:8053017-8053039 GGTCCTCCTCCCTGGGCACCTGG - Exonic
1163035310 19:14566150-14566172 GGTCCACTTCCCCGGGTCCCTGG + Exonic
1163739754 19:19004238-19004260 GATCCTCTTCCGAGGGAAGCAGG + Exonic
1168727856 19:58599138-58599160 GGTGCTCTTCCGAGGATATCTGG - Intergenic
925483486 2:4302761-4302783 GGTCCTCTCTCCTGGGGATCAGG - Intergenic
925491580 2:4400973-4400995 GGACTTCTTCCCAGTGTGTCTGG - Intergenic
925579871 2:5399376-5399398 GGGCCCCGTCCCAGGGTTTCTGG - Intergenic
925739672 2:6994786-6994808 GGGCCTCTTCCAAGGGCAGCTGG - Intronic
926306172 2:11638860-11638882 GGTCCCCTCCTCAGGGTACCCGG - Intronic
929143307 2:38685271-38685293 GGTCCTCTTCCCTGAATATCTGG + Intronic
929671435 2:43878964-43878986 GCTCCTCTTCACAGGGTAGCGGG - Intergenic
930480735 2:51944790-51944812 GCACCTCTTCCCAGGGTGGCAGG - Intergenic
930708674 2:54529518-54529540 GGTGGTCTTCCGAGGATATCTGG - Intronic
931493960 2:62782586-62782608 GCACCTCTTCACAGGGTAGCAGG + Intronic
933532704 2:83530639-83530661 GCACCTCTTCACAGGGTGTCAGG - Intergenic
935692281 2:105742780-105742802 GCTCCTCCTCCCATGGTTTCAGG - Intergenic
936013008 2:108936972-108936994 GGTCCTGTTCCCAGCCTCTCTGG + Intronic
936570703 2:113612054-113612076 GGTGCTCTTCTGAGGCTATCTGG + Intergenic
937288654 2:120768736-120768758 GGTCCTGCTCCCAGGATGTCAGG + Intronic
937867971 2:126768172-126768194 GCACCTCTTCCCAGGGTGGCAGG + Intergenic
938121462 2:128637069-128637091 TGTCCTCTTCCCAGGCTCCCAGG + Intergenic
939271553 2:139946108-139946130 GGTACTCTTCCCATGGTTGCTGG - Intergenic
943321046 2:186443301-186443323 GCACCTCTTCACAGGGTAGCAGG - Intergenic
944644252 2:201762777-201762799 GTTCCCCATCCCAGGGTCTCTGG - Intronic
947628770 2:231637985-231638007 GTTCCTCTCCTCCGGGTATCGGG - Intergenic
949088153 2:242175340-242175362 GGTGCTCTTCCGAGGATATCTGG - Intergenic
1170446591 20:16434293-16434315 GGTCTTCTTCCCACGAGATCTGG - Intronic
1170715366 20:18826529-18826551 GGCCCTCCTCTCAGGGAATCAGG + Intronic
1171168467 20:22994164-22994186 GGTCCTTCTCCCAGGGCATGTGG - Intergenic
1171375982 20:24694346-24694368 GGGCCTCCTCCCAGGTTCTCTGG - Intergenic
1171519542 20:25765341-25765363 GGTCCAGTTCCCAGGGATTCTGG + Intronic
1171557379 20:26091152-26091174 GGTCCAGTTCCCAGGGATTCTGG - Intergenic
1171794260 20:29554295-29554317 AGTTCTCTTCCCACTGTATCAGG + Intergenic
1171854213 20:30330096-30330118 AGTTCTCTTCCCACTGTATCAGG - Intergenic
1173205763 20:40991831-40991853 GGTCTCCTTCCCAGGCTCTCAGG - Intergenic
1173406987 20:42774884-42774906 GGTCCTCTTCCCTGCGTTCCTGG + Intronic
1174082400 20:47979750-47979772 GGTCCTATTCCCTGGGGATCCGG - Intergenic
1174134151 20:48367488-48367510 GGTCCTATTCCCTGGGGATCCGG + Intergenic
1174527112 20:51181526-51181548 GGTCCTCTTTTGAGGGTATGAGG + Intergenic
1174718163 20:52782823-52782845 GGTCATCTTTCCTGGGTGTCAGG + Intergenic
1175595508 20:60228340-60228362 GGTCCTTTTCACAGGGTTCCTGG + Intergenic
1175912613 20:62412041-62412063 GGCCCTGGTCCGAGGGTATCGGG - Intronic
1176653686 21:9571618-9571640 GGTCCTGTTCCCAGGGATTCTGG + Intergenic
1177140404 21:17352409-17352431 TGACCTCTTCCCAGTGTCTCTGG - Intergenic
1179191709 21:39127742-39127764 GGTGCTCTTCCAAGGATATTTGG - Intergenic
1180263293 21:46690932-46690954 GGTGCTCTTCCGAGGATATCTGG - Intergenic
1182815632 22:33161090-33161112 GGACCTCTTCACAGGGTGGCAGG + Intergenic
1182832297 22:33313817-33313839 GGCCCTCTGCCCAGGGTCTCAGG - Intronic
1184255181 22:43282401-43282423 GTGCCTCTCCCCAGGGTTTCTGG + Intronic
1185429496 22:50798826-50798848 GGTGCTCTTCCGAGGATATCTGG - Intergenic
949229163 3:1730199-1730221 GGTGCTCTTCCGAGGATATTTGG - Intergenic
950199757 3:11034638-11034660 GGTCCTCATCCCCGGGTACATGG + Exonic
950453349 3:13078178-13078200 GGTTCTCTCCCCAGGGGAGCAGG - Intergenic
951699505 3:25480917-25480939 GATCCTATTCCCAGAGTTTCAGG + Intronic
952233195 3:31453359-31453381 AGTCCTCTTCCGAGGATAGCCGG + Intergenic
954871203 3:53768827-53768849 GGGCCTCCTCCCTGGGGATCTGG - Intronic
955003380 3:54947583-54947605 AGGCCTATTCCCAGGGCATCAGG - Intronic
956152577 3:66259071-66259093 GGTCCTCCTGCCAGGGTAGGAGG + Intronic
956698445 3:71938192-71938214 GCACCTCTTCACAGGGTAGCAGG + Intergenic
957079592 3:75624961-75624983 GGTGTTCTTCCGAGGATATCTGG + Intergenic
959304997 3:104651360-104651382 GCACCTCTTCCCAGGGTGGCAGG - Intergenic
959801036 3:110495540-110495562 GGTGCTCTTCCCAGGGAGACGGG - Intergenic
960400603 3:117193094-117193116 GCACCTCTTCACAGGGTAGCAGG + Intergenic
960495489 3:118368617-118368639 GCACCTCTTCACAGGGTAGCAGG + Intergenic
963122368 3:141787068-141787090 GGTCCTCTTCCAAGTGTATGTGG - Intronic
963388127 3:144622708-144622730 TGTCCTCTTACCAAGGTAACTGG - Intergenic
965611607 3:170549660-170549682 GTGCCTCTCCCCAGGGCATCGGG - Intronic
966932866 3:184687128-184687150 GGTAATCTTCCCCGGGTATTGGG + Intergenic
967138302 3:186531089-186531111 GCTCCTCTTCCCAGGGCCTAAGG + Intergenic
967633235 3:191771614-191771636 GCTCCTCATCCTAGGGAATCTGG - Intergenic
968044648 3:195617223-195617245 GCACCTCTCCCCAGGGCATCAGG - Intergenic
968060436 3:195723274-195723296 GCACCTCTCCCCAGGGCATCAGG - Intronic
968075094 3:195811945-195811967 TGTCCTCTTCCCAGGTTCCCTGG - Exonic
968550000 4:1217206-1217228 AGTCCTCTTCCCAGAGTGACTGG - Intronic
968572211 4:1347619-1347641 GGTGCTCGGCCCTGGGTATCCGG + Exonic
969917517 4:10505190-10505212 TATCCTCTTTCCAGGGAATCTGG - Intronic
969925528 4:10582180-10582202 GGTTCTCTCCCCAGGGTGTTGGG - Intronic
972007757 4:34132452-34132474 GCACCTCTTCACAGGGTAGCAGG - Intergenic
972718779 4:41675366-41675388 GTTCATCTTCCCAGGCTACCAGG + Intronic
974443658 4:61951395-61951417 GGCTCTCTTTCCAGGGTCTCAGG + Intronic
979700142 4:123657740-123657762 GCACCTCTTCACAGGGTAGCAGG + Intergenic
985125464 4:186689684-186689706 TGTCCTTAGCCCAGGGTATCTGG + Intronic
985465941 4:190195894-190195916 GGTGCTCTTCCGAGGATATCTGG - Intergenic
985620483 5:952381-952403 GATCCTCTTCCCAAGGTCCCAGG + Intergenic
985672081 5:1212289-1212311 GGCCCTCTCCCCAGGGTATGTGG + Exonic
987918398 5:24247142-24247164 GGTCCTCTTGCTTAGGTATCTGG - Intergenic
988125568 5:27029556-27029578 GGTGCTCTTCCCAGCGCAGCAGG + Intronic
988155992 5:27449293-27449315 GGACCTCTTCACAGGGTGGCAGG - Intergenic
989716757 5:44472703-44472725 GCACCTCTTCACAGGGCATCAGG + Intergenic
992912292 5:81407908-81407930 GCTCCTCTTCACAGGGTGGCAGG + Intergenic
996033250 5:118730271-118730293 GGACCTCTTCACAGGGTGGCGGG + Intergenic
997128841 5:131256525-131256547 GGTTCTCTGCTCACGGTATCAGG + Intronic
997922779 5:137998824-137998846 GGTCCTCTTCCCTGGGTCACCGG + Intronic
997953741 5:138262360-138262382 GGTCCTCTTCCCTGGGAATAGGG - Intronic
998310463 5:141124182-141124204 GGGCCCCTTTCCAGGGCATCTGG + Exonic
998311620 5:141137618-141137640 GGGCCCCTTTCCAGGGCATCTGG + Exonic
998313595 5:141158187-141158209 GGGCCCCTTTCCAGGGCATCTGG + Intergenic
998315663 5:141180224-141180246 GGGCCCCTTTCCAGGGCATCTGG + Exonic
998318067 5:141201961-141201983 GGGCCCCTTTCCAGGGCATCTGG + Exonic
998322806 5:141247765-141247787 GGGCCCCTTTCCAGGGCATCTGG + Exonic
998377836 5:141702735-141702757 GGTCATCTGCCCAGGGCAGCGGG - Intergenic
998685307 5:144517665-144517687 GGTCCTATGCCCAGGGAGTCTGG + Intergenic
1000713909 5:164616124-164616146 GTTCCTCTTCACAGTGCATCTGG - Intergenic
1002740889 5:181434503-181434525 AGTCATCTTCCCAAGGTGTCAGG + Intergenic
1002745891 5:181472134-181472156 GGTGCTCTTCCGAGGATATCTGG - Intergenic
1005147121 6:22704260-22704282 GGTCCTTTTCTCAGGGTATAGGG + Intergenic
1005838829 6:29726944-29726966 GGTGCTCTTCCAAGGATATTTGG + Exonic
1006150311 6:31983501-31983523 AGTCCTCTTCCCAGGGAAGCAGG + Intronic
1006156612 6:32016239-32016261 AGTCCTCTTCCCAGGGAAGCAGG + Intronic
1006445144 6:34075935-34075957 GCTCCCATTCCCAGGGTATCTGG - Intronic
1007864946 6:44958068-44958090 GCCCCTCTTCCCAACGTATCAGG + Intronic
1012967279 6:105688066-105688088 GTACCTCTTCACAGGGTAACAGG - Intergenic
1013799828 6:113930405-113930427 GAACCTCTTCACAGGGTAGCAGG + Intergenic
1015105619 6:129532966-129532988 GCACCTCTTCCCAGGGCAGCAGG + Intergenic
1018636072 6:165860497-165860519 GGTCCTTTGCCCAGGGTATCTGG - Intronic
1019250808 6:170745689-170745711 GGTGCTCTTCCGAGGATATCTGG - Intergenic
1020007827 7:4791795-4791817 GGTCCTCTCCCCAGGGTGCAGGG - Intronic
1020398215 7:7742354-7742376 GGCGCTCTTCCGAGGATATCTGG + Intronic
1020663187 7:11006677-11006699 GGAGCTCTTCCGAGGATATCTGG + Intronic
1022810787 7:33866338-33866360 GCACCTCTTCACAGGGCATCAGG - Intergenic
1024256300 7:47542490-47542512 AGTCATCTGCCCAGAGTATCTGG - Intronic
1024596696 7:50944067-50944089 GGTCCTCTTCCCAGCTCATACGG + Intergenic
1024761406 7:52601071-52601093 GTACCTCTTCCCAGGGTGGCAGG - Intergenic
1025280032 7:57620277-57620299 GGTCCAGTTCCCAGGGATTCTGG + Intergenic
1030143302 7:106327399-106327421 TGTTCTCTTCCCAGGGAATTTGG + Intergenic
1033444001 7:141404527-141404549 GATCCTCTTCCCTGAGTCTCTGG + Intronic
1033860951 7:145626639-145626661 TTTCCTCTTCCCAGGTAATCTGG + Intergenic
1035502125 8:98099-98121 AGTCATCTTCCCAAGGTGTCAGG - Intergenic
1035513747 8:213517-213539 GGTGCTCTTCCGAGGATATCTGG + Intergenic
1037636342 8:20704012-20704034 AGACCCCTTCCCAGGGTCTCAGG + Intergenic
1037660123 8:20919241-20919263 GTACCTCTTCACAGGGTAGCAGG + Intergenic
1038154522 8:24976055-24976077 GTACCTCTTCACAGGGTAGCAGG - Intergenic
1038412459 8:27368850-27368872 GTTCTTCTTTCCAGGGTCTCCGG - Intronic
1044208788 8:89524018-89524040 GGTACTCTTCCCACTGGATCTGG - Intergenic
1044870936 8:96619294-96619316 TCTCCTCTTCTCAGGATATCGGG + Intergenic
1045833803 8:106496267-106496289 GGTCCTGCTCCCAGAGTTTCTGG - Intronic
1047060310 8:121218415-121218437 GCACCTCTTCACAGGGCATCAGG + Intergenic
1048231153 8:132643185-132643207 GGTTCTCTACCCAGGGTTTGGGG + Intronic
1048480220 8:134783246-134783268 GGTCCTCGGCCCAGGGGATGGGG - Intergenic
1049438201 8:142597347-142597369 GGTCCTCTCCCCACGGTGGCTGG - Intergenic
1049644115 8:143728449-143728471 GGCCCTCTTCCCGGGGTGGCGGG + Exonic
1049967144 9:790157-790179 GGTCCTCTTCCCTCTGTGTCTGG + Intergenic
1051423441 9:16911671-16911693 GGTTCTCTGCCCAGGTTTTCAGG - Intergenic
1052626553 9:30982806-30982828 GCACCTCTTCACAGGGCATCAGG + Intergenic
1053020681 9:34691800-34691822 GGGCCTCCTCCCAAGGTACCTGG - Intergenic
1053792021 9:41693377-41693399 AGTTCTCTTCCCACTGTATCAGG - Intergenic
1054180426 9:61905397-61905419 AGTTCTCTTCCCACTGTATCAGG - Intergenic
1054472929 9:65552592-65552614 AGTTCTCTTCCCACTGTATCAGG + Intergenic
1054657165 9:67675745-67675767 AGTTCTCTTCCCACTGTATCAGG + Intergenic
1055486373 9:76760147-76760169 CTTCCTCTTCCCTGGGTACCTGG + Intronic
1056743102 9:89276998-89277020 GCACCTCTTCACAGGGTAGCAGG + Intergenic
1056826725 9:89881002-89881024 GGCTCTCTTCCCAGGGTCACTGG - Intergenic
1057495292 9:95555580-95555602 AGTGCTCTTCCCCAGGTATCCGG + Intergenic
1057873099 9:98732784-98732806 AGTGCTCTTTCCAGGGTAACAGG + Exonic
1058101658 9:100924005-100924027 GCACCTCTTCACAGGGTATCAGG - Intergenic
1060187866 9:121574876-121574898 GCGCCTCTTCCCAGAGTCTCAGG - Intronic
1060663251 9:125416570-125416592 GTTCTTCGTGCCAGGGTATCTGG + Intergenic
1060980423 9:127788530-127788552 GCTCTTCTTCCCAGGGGAGCGGG + Exonic
1061329576 9:129884082-129884104 GATTCTCTTCCCAGGGGTTCGGG + Intergenic
1062175039 9:135156951-135156973 GTTCCTCTTCCAAGGCTTTCAGG + Intergenic
1062599289 9:137312732-137312754 GGGTCTGTTCCCAGGGTGTCTGG + Intronic
1203580360 Un_KI270745v1:38286-38308 GGTGCTCTTCCGAGGATATCTGG - Intergenic
1203606197 Un_KI270748v1:59310-59332 AGTCATCTTCCCAAGGTGTCAGG + Intergenic
1203631406 Un_KI270750v1:75065-75087 GGTCCTGTTCCCAGGGATTCTGG + Intergenic
1185813685 X:3133533-3133555 GGTCCTATTCCCAGGTTCTGAGG + Intergenic
1189193226 X:39129619-39129641 GGTCCCCTTCTTAGGGAATCTGG + Intergenic
1192378988 X:70594825-70594847 GCACCTCTTCACAGGGTAGCAGG - Intronic
1193532574 X:82674356-82674378 TGACCTCTTCCCAGGGTGTAGGG + Intergenic
1194522605 X:94936744-94936766 GCACCTCTTCACAGGGTAGCAGG - Intergenic
1194582715 X:95696617-95696639 GCACCTCTTCACAGGGTAGCAGG - Intergenic
1196543499 X:116936739-116936761 GCACCTCTTCCCAGGGCAGCAGG + Intergenic
1197151278 X:123222636-123222658 GATTCTGTTCCCAGGGTTTCTGG + Intronic
1197804648 X:130387111-130387133 GGTCCTACTCCCAGAGTTTCAGG + Intergenic
1199301583 X:146220214-146220236 GGACCTCTTCACAGGGTGGCAGG + Intergenic
1200389512 X:155930056-155930078 TGTCCTCTTCCCATGGAGTCAGG + Intronic
1200683649 Y:6242584-6242606 AGTCCACTTCACAGGGAATCTGG - Intergenic
1201048986 Y:9911802-9911824 AGTCCACTTCACAGGGAATCTGG + Intergenic
1201267937 Y:12227016-12227038 GGTCCTATTCCCATGTTCTCTGG - Intergenic