ID: 1108642734

View in Genome Browser
Species Human (GRCh38)
Location 13:52397542-52397564
Sequence GGCCAGGTCAATGGGTCCTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 1, 2: 2, 3: 7, 4: 179}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108642727_1108642734 -1 Left 1108642727 13:52397520-52397542 CCAGTTTGTATCCAAATTTCTGG 0: 1
1: 0
2: 1
3: 15
4: 205
Right 1108642734 13:52397542-52397564 GGCCAGGTCAATGGGTCCTGTGG 0: 1
1: 1
2: 2
3: 7
4: 179
1108642724_1108642734 30 Left 1108642724 13:52397489-52397511 CCGGACTCACATGTGAGTTCTGG 0: 1
1: 0
2: 0
3: 17
4: 131
Right 1108642734 13:52397542-52397564 GGCCAGGTCAATGGGTCCTGTGG 0: 1
1: 1
2: 2
3: 7
4: 179
1108642726_1108642734 5 Left 1108642726 13:52397514-52397536 CCATCACCAGTTTGTATCCAAAT 0: 1
1: 0
2: 1
3: 13
4: 157
Right 1108642734 13:52397542-52397564 GGCCAGGTCAATGGGTCCTGTGG 0: 1
1: 1
2: 2
3: 7
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108642734 Original CRISPR GGCCAGGTCAATGGGTCCTG TGG Exonic
900683160 1:3929010-3929032 GGTCACGCCCATGGGTCCTGGGG - Intergenic
901203757 1:7482354-7482376 GGCCAGGTCACTACTTCCTGGGG + Intronic
901417872 1:9129464-9129486 GCCCAGGTCTCTGGGCCCTGTGG - Intergenic
901812308 1:11774881-11774903 GGCCAGGTCAGAGGCTGCTGAGG + Intronic
902415099 1:16233785-16233807 GGCAGGGTCAAGGGGTGCTGTGG + Intronic
902738813 1:18419951-18419973 GGCTTGGACAATGGGCCCTGTGG - Intergenic
902781078 1:18705472-18705494 GGCCTGGCCAATGTGTACTGGGG - Intronic
903995046 1:27300398-27300420 GGACAGGTCTGTGGGTGCTGGGG + Intronic
904594182 1:31632698-31632720 GGCTGCCTCAATGGGTCCTGAGG - Intronic
905905956 1:41618666-41618688 GCTCAGGTCACTGGGGCCTGGGG - Intronic
907664015 1:56418418-56418440 GGCCAGGTCTCTGGGGTCTGGGG - Intergenic
910258290 1:85271826-85271848 GGCTAGGTGAAGGGTTCCTGTGG + Intronic
915523901 1:156464629-156464651 GGCCAGATGAATGGGTCCCTGGG - Exonic
915589985 1:156865147-156865169 GGCCAAGTCAATGAGTCCCTGGG - Intronic
915715093 1:157937915-157937937 GGTCAGGCAAATGGTTCCTGTGG + Intergenic
915979732 1:160412493-160412515 GGCCAGTAGAATGGGTCCTCAGG + Intronic
917517203 1:175718253-175718275 GGCCAGGACAGGGGGTGCTGGGG - Intronic
919764197 1:201115650-201115672 GGCCATGCCCATGGGTGCTGCGG - Exonic
921301917 1:213759640-213759662 GGCCAGGCCACTGAGTACTGGGG - Intergenic
923301362 1:232643589-232643611 GGGCAGGTCACTGTGTACTGGGG + Intergenic
924106532 1:240654612-240654634 GTCCATGTCAGTGGGGCCTGGGG - Intergenic
924293825 1:242565764-242565786 GGACAAGTCAATAGGTCCAGAGG + Intergenic
924794587 1:247284271-247284293 GGGCAGGTGATTGGGTCATGGGG - Intergenic
1063957032 10:11276717-11276739 GAGAAGGTCACTGGGTCCTGAGG + Intronic
1064118812 10:12601954-12601976 GCCCAGGGCAAGGGATCCTGTGG + Intronic
1066502135 10:36004333-36004355 GTCCAGGTCACAGTGTCCTGAGG + Intergenic
1067055400 10:43046898-43046920 GGGCAGGGCACTGTGTCCTGAGG - Intergenic
1067405862 10:46023183-46023205 GGCGAGGGCAAGGGCTCCTGAGG - Intronic
1067683633 10:48454985-48455007 GGGGAGGTCAGTGGCTCCTGGGG - Exonic
1068120908 10:52781114-52781136 GGCCAGGTCCATGTTTCCTAGGG - Intergenic
1069899777 10:71700790-71700812 GCCCCTGTCCATGGGTCCTGGGG - Intronic
1071307759 10:84314245-84314267 GCCAAGGTCTCTGGGTCCTGAGG + Intergenic
1072761081 10:98057377-98057399 GGCCAGCTGCATGCGTCCTGGGG + Intergenic
1073142880 10:101260837-101260859 TGCCAGGGCAGTGGGTTCTGAGG - Intergenic
1074455886 10:113594840-113594862 GGCCTGGCCATTGTGTCCTGGGG - Intronic
1076615787 10:131753606-131753628 CACCAGGTCAGTGGGTTCTGAGG - Intergenic
1076781908 10:132729087-132729109 GGCCTGGACGCTGGGTCCTGTGG + Intronic
1077111781 11:865276-865298 GGGGAGGACCATGGGTCCTGGGG - Intronic
1079146504 11:17857079-17857101 AGCCAAGTCAAGGGCTCCTGAGG + Intronic
1084889665 11:72230484-72230506 GGCCAGGCCACTGGGGACTGCGG + Intronic
1086342091 11:85857248-85857270 GGCCATCTCCATGGGTCCTATGG - Intronic
1087779667 11:102288781-102288803 GGCCAGGTCAGCTGGGCCTGAGG - Intergenic
1089816586 11:121182220-121182242 GGCCAGGTGGGTGGGTCCTCAGG + Intronic
1091343732 11:134839349-134839371 GGTAAGATGAATGGGTCCTGGGG - Intergenic
1091783308 12:3227580-3227602 GGACAGGAAAATGGGTCATGAGG + Intronic
1098180246 12:67839891-67839913 GGCCAGGTGAGTGGGTCCTTAGG + Intergenic
1103322865 12:120101961-120101983 GGGCAGGGCAGTGGGGCCTGGGG - Intronic
1104811855 12:131624172-131624194 GGCCTGGGCAATGGGTTCCGGGG - Intergenic
1105468076 13:20665947-20665969 GGCCACGTTTATGGGTCCTTTGG + Intronic
1105890810 13:24681013-24681035 GGCCAGCTCCATGGCACCTGCGG + Intronic
1107546102 13:41434989-41435011 GGGCAGTTCAGTGAGTCCTGAGG - Intergenic
1108642734 13:52397542-52397564 GGCCAGGTCAATGGGTCCTGTGG + Exonic
1119119825 14:72064284-72064306 GGTCAAGTCAATGGATCCAGAGG + Intronic
1122604975 14:102942149-102942171 GTCCAGGACAAGGGGTGCTGAGG + Intronic
1124113622 15:26817887-26817909 GGACACATCAATGTGTCCTGAGG + Intronic
1124155239 15:27219530-27219552 GGTCATGTCCATGGATCCTGTGG + Intronic
1128092951 15:64931370-64931392 GGAGAGCTCAAGGGGTCCTGGGG + Intronic
1129538550 15:76333454-76333476 GGCCACATCAATGGTGCCTGTGG + Intergenic
1131620902 15:94067105-94067127 GGTCAGGACAATGGATTCTGGGG + Intergenic
1132581392 16:686288-686310 GGCCTGGACATTGGGTACTGAGG - Intronic
1138438233 16:57018609-57018631 GGCCAGTACTATGCGTCCTGGGG - Intronic
1140458187 16:75116535-75116557 GGTCAGGTCACTTGGTGCTGGGG + Intronic
1141035624 16:80623048-80623070 GGCCAGCTCAAAGCTTCCTGCGG + Intronic
1142328221 16:89432372-89432394 TGCCACGGCGATGGGTCCTGAGG - Intronic
1142656552 17:1398647-1398669 GGTCATGTCTGTGGGTCCTGTGG - Intronic
1147644714 17:42026906-42026928 GGCAAGGACGATAGGTCCTGTGG + Intronic
1148199434 17:45740136-45740158 GGCCTGGACTTTGGGTCCTGTGG + Intergenic
1148216181 17:45835109-45835131 GGCCAGCCCACTGGGCCCTGGGG + Exonic
1148216312 17:45835693-45835715 GGGCAGGTCAGTGGGGGCTGCGG - Exonic
1149648055 17:58254747-58254769 GTGCAGGTTACTGGGTCCTGGGG + Intronic
1151243587 17:72777250-72777272 TGCCAGGTCAAAGGGGACTGGGG + Intronic
1151529021 17:74692493-74692515 GTCCATATCAATGTGTCCTGGGG - Intronic
1152029216 17:77831234-77831256 CCCCAGGTCCCTGGGTCCTGAGG + Intergenic
1152869309 17:82743479-82743501 GGAGGGCTCAATGGGTCCTGGGG + Intronic
1155515393 18:26619652-26619674 AGCCTGGGCAATGGGACCTGAGG + Intronic
1160301747 18:77687804-77687826 GTCCAGGTCATTGGGAGCTGAGG - Intergenic
1161588728 19:5119047-5119069 GGCCAGGACCAGGCGTCCTGGGG + Intronic
1162003674 19:7763887-7763909 GACCAGATTACTGGGTCCTGGGG + Intronic
1162024785 19:7887795-7887817 GGCCAGGTGACTGGGCCTTGCGG + Intergenic
1163253578 19:16141337-16141359 GGCCAGGGCAATAGGCCCTTGGG + Intronic
1163267298 19:16228742-16228764 GGCCAGGCCAATGCGGCCCGGGG - Intronic
1164658337 19:29940876-29940898 GGCCAGATCAATGGTTGCTGAGG + Intronic
1164839335 19:31380730-31380752 GTCCAGCACAATGGGTCCAGAGG - Intergenic
1166801252 19:45458665-45458687 GGCCAAGTCAGTGGGTCTTTAGG + Intronic
1166804008 19:45474105-45474127 GGCCAGGGCTGAGGGTCCTGAGG - Exonic
1167571929 19:50293715-50293737 TCCCAGGTCAATGGGGACTGAGG - Intronic
1168062214 19:53899181-53899203 GGCCAGGTGAATGGGTCCTGCGG + Intronic
1168136466 19:54355493-54355515 GGCCATCTCCATGGGCCCTGAGG + Intronic
1202648561 1_KI270706v1_random:161284-161306 GGCCAGGTAACTGCGTCATGTGG + Intergenic
925345511 2:3169345-3169367 GGCCTCATCAATGCGTCCTGTGG + Intergenic
926008433 2:9390337-9390359 GGCCAGGCCACTGGGTCCAGAGG - Intronic
926163942 2:10506414-10506436 TGTCAGGTCACTGGTTCCTGAGG + Intergenic
929239670 2:39641098-39641120 GGTAAGATGAATGGGTCCTGGGG - Intergenic
929805428 2:45140773-45140795 GTCCTGGTCAATGGGACCTGGGG + Intergenic
931036967 2:58254617-58254639 GGCAATGTCAATCAGTCCTGAGG - Intergenic
932749453 2:74362079-74362101 GGCAAAGTCAGTGGGTACTGTGG + Exonic
933254055 2:80060507-80060529 AGCCAGGTCATGGGGTCTTGGGG - Intronic
934520391 2:95016705-95016727 GGCCTGGTTCAGGGGTCCTGAGG - Intergenic
935228058 2:101071406-101071428 GGCCTGGTTATTGGGCCCTGTGG + Intronic
935816606 2:106852188-106852210 GGCCAGGTCAGCGGAGCCTGTGG + Intronic
938194503 2:129314859-129314881 AGCCAGGCCAATGGGTCTTAGGG - Intergenic
939712235 2:145536672-145536694 GGCCAGGAGGATGGTTCCTGTGG - Intergenic
940382677 2:153033478-153033500 GGCCAGGCCAATGGGTCCTTGGG - Intergenic
942629283 2:177938516-177938538 AGCCAGGTCAATGGGATGTGAGG - Intronic
942832217 2:180250727-180250749 GGCCTGGTCCATGAGGCCTGAGG + Intergenic
945001901 2:205360669-205360691 GGCCAGGTGCATGGGCTCTGGGG + Intronic
1173735145 20:45355557-45355579 GGCCAAGCCAATGAGTCTTGTGG - Intergenic
1174602613 20:51737046-51737068 GGGCAGGTCACTGAGTCCTCTGG - Intronic
1174945453 20:54980305-54980327 GGCCATGGCAATGGGTCCTGTGG + Intergenic
1175575318 20:60056551-60056573 GGCCAGGCACATGGGCCCTGTGG + Intronic
1176031979 20:63017184-63017206 GGCCACATCAACGGGTCCTGGGG + Intergenic
1177651495 21:23965933-23965955 CGGCAGGTCAATAGGTGCTGGGG - Intergenic
1178215444 21:30592500-30592522 GGCCATGGCTATGGGTGCTGTGG + Exonic
1180352137 22:11814352-11814374 GGCCAGGTAACTGCGTCATGTGG + Intergenic
1180353344 22:11821201-11821223 GGCCAGGTAACTGCGTCATGTGG - Intergenic
1180384897 22:12171156-12171178 GGCCAGGTAACTGCGTCATGTGG + Intergenic
1180386069 22:12177714-12177736 GGCCAGGTAACTGCGTCATGTGG - Intergenic
1181645997 22:24232152-24232174 GGCCATGGGAGTGGGTCCTGAGG + Exonic
1183830693 22:40417154-40417176 GGGCACGCCCATGGGTCCTGTGG - Intronic
1184112109 22:42401532-42401554 GGCCGGGGCAAGGGGTCCCGTGG + Intronic
1184551988 22:45209425-45209447 GGCCTGGTGGGTGGGTCCTGGGG - Intronic
1185045573 22:48527130-48527152 GGCCTGGTCAATTGGCCCAGGGG - Intronic
950678774 3:14570427-14570449 GGCCAGGACCAGGGGTGCTGAGG + Intergenic
951758568 3:26119251-26119273 GGCCTGGTGAATGGATCATGAGG + Intergenic
952413540 3:33070387-33070409 GGGAAGGTCTATGTGTCCTGTGG - Intronic
953046577 3:39298382-39298404 GGCCAGGCCGATGGGTTCTCAGG - Intergenic
953916704 3:46925094-46925116 GGGCAGGGTGATGGGTCCTGTGG - Intronic
959162637 3:102739562-102739584 AGGCAGGTCAATAGGCCCTGGGG + Intergenic
961166509 3:124767169-124767191 GGCAATGGCAATGGGTCCTGGGG + Intronic
968517148 4:1020185-1020207 GGCCATCTCGATGGGGCCTGGGG - Intronic
973374790 4:49279248-49279270 GGCCAGGTAACTGCGTCATGTGG + Intergenic
973375691 4:49285270-49285292 GGCCAGGTAACTGCGTCATGTGG + Intergenic
973376589 4:49291289-49291311 GGCCAGGTAACTGCGTCATGTGG + Intergenic
973377508 4:49297441-49297463 GGCCAGGTAACTGCGTCATGTGG + Intergenic
973378426 4:49303577-49303599 GGCCAGGTAACTGCGTCATGTGG + Intergenic
973379730 4:49311786-49311808 GGCCAGGTAACTGCGTCATGTGG - Intergenic
973380634 4:49317926-49317948 GGCCAGGTAACTGCGTCATGTGG - Intergenic
973381720 4:49324971-49324993 GGCCAGGTAACTGCGTCATGTGG - Intergenic
973382621 4:49330993-49331015 GGCCAGGTAACTGCGTCATGTGG - Intergenic
985616267 5:923561-923583 GGCAAGGGAAAGGGGTCCTGCGG - Intergenic
986643191 5:9891950-9891972 GGCCAGCCCATGGGGTCCTGGGG - Intergenic
988408137 5:30850720-30850742 AGCCAACTCAGTGGGTCCTGTGG - Intergenic
997697234 5:135871477-135871499 GTCCAGGGCAGTGGCTCCTGCGG + Intronic
998719435 5:144927592-144927614 GGCCTGGTCCCTGGATCCTGTGG - Intergenic
999347897 5:150840516-150840538 GACCAGGCCTTTGGGTCCTGGGG + Intergenic
1000237748 5:159377939-159377961 GGCCAGTTCACTGTGTCCTATGG - Intergenic
1000565500 5:162841748-162841770 GGCCATGTCAAAGGGTCATAGGG + Intergenic
1000995324 5:167952732-167952754 GGCCAGGTCATTGGGCGCTGGGG - Exonic
1001550412 5:172598453-172598475 GGCCAGGGTGATGGCTCCTGTGG + Intergenic
1006856453 6:37137087-37137109 GGCCGGGTAAGTGGCTCCTGAGG - Intergenic
1007262699 6:40575021-40575043 AGCCATGGCAATGGGTCCTTAGG + Intronic
1007581752 6:42964065-42964087 GGCCAGGGCCTTGGGTTCTGGGG - Exonic
1013469279 6:110447234-110447256 TCCCAGGTTAAAGGGTCCTGCGG - Intronic
1015218961 6:130782330-130782352 GGCAAGGTGATTGGGTCATGAGG + Intergenic
1018246049 6:161825427-161825449 GACGAGGCCAAGGGGTCCTGAGG - Intronic
1019145192 6:169971512-169971534 GGCCTGGAGATTGGGTCCTGCGG - Intergenic
1023984305 7:45086021-45086043 GGCCAGGTGGCTGGGCCCTGGGG + Exonic
1024510118 7:50197324-50197346 GGACTGGGCCATGGGTCCTGAGG - Intergenic
1024641059 7:51328978-51329000 GGCCAGGGCAAGGGGTGGTGGGG - Intergenic
1034197722 7:149261426-149261448 GCCGAGGAAAATGGGTCCTGCGG + Intergenic
1034440093 7:151081884-151081906 GGCCGGGAAACTGGGTCCTGAGG + Exonic
1036560662 8:9898431-9898453 GGACACGTCTCTGGGTCCTGGGG + Intergenic
1037944923 8:22982985-22983007 GGGCAGGTCATCGGGTCATGAGG - Intronic
1040525368 8:48218119-48218141 GGCGTGGTCCATAGGTCCTGGGG - Intergenic
1043053394 8:75408077-75408099 GGCCTGGCCTAGGGGTCCTGAGG - Intronic
1047400949 8:124546948-124546970 GGATAGGTAAATGTGTCCTGTGG + Intronic
1049007217 8:139863255-139863277 GGCCTGCTCACTGAGTCCTGGGG - Intronic
1052988695 9:34506033-34506055 GCCCAGGTCAAGTGGGCCTGTGG + Intronic
1053164678 9:35836012-35836034 GGCCACGTGCATGGGGCCTGTGG + Intronic
1056552440 9:87663377-87663399 GGCCAGGTTCATGGGGCCTTTGG - Intronic
1060200536 9:121649631-121649653 AGCCAGGTCCACGGGTTCTGGGG - Intronic
1061010051 9:127949507-127949529 GGCCAGATCAAGGGAGCCTGGGG - Intronic
1061207088 9:129171066-129171088 GGCCATGTTAATGTTTCCTGCGG + Intergenic
1062055505 9:134467863-134467885 GGAAAGGTAAATGGGCCCTGAGG - Intergenic
1062102277 9:134734500-134734522 GGCCAGGTCCTGGGGCCCTGCGG + Intronic
1062376986 9:136266331-136266353 GCCCAGGCCAGTGGGTCCTCTGG + Intergenic
1203699414 Un_GL000214v1:123504-123526 GGCCAGGTAACTGCGTCATGTGG + Intergenic
1203700358 Un_GL000214v1:129787-129809 GGCCAGGTAACTGCGTCATGTGG + Intergenic
1203701280 Un_GL000214v1:135807-135829 GGCCAGGTAACTGCGTCATGTGG + Intergenic
1203480105 Un_GL000224v1:4390-4412 GGCCAGGTAACTGCGTCATGTGG + Intergenic
1203481075 Un_GL000224v1:10718-10740 GGCCAGGTAACTGCGTCATGTGG + Intergenic
1203482038 Un_GL000224v1:17027-17049 GGCCAGGTAACTGCGTCATGTGG + Intergenic
1203416710 Un_KI270330v1:217-239 GGCCAGGTAACTGCGTCATGTGG - Intergenic
1203548602 Un_KI270743v1:150747-150769 GGCCAGGTAACTGCGTCATGTGG + Intergenic
1203549815 Un_KI270743v1:157658-157680 GGCCAGGTAACTGCGTCATGTGG - Intergenic
1203550756 Un_KI270743v1:163823-163845 GGCCAGGTAACTGCGTCATGTGG - Intergenic
1203569705 Un_KI270744v1:119741-119763 GGCCAGGTAACTGCGTCATGTGG + Intergenic
1186472542 X:9832679-9832701 TTGCAGGTCAATGTGTCCTGGGG + Intronic
1189954550 X:46263914-46263936 GGCCAGGTAAAAAGATCCTGTGG + Intergenic
1192229157 X:69252857-69252879 GGCCATGCCACTGGGTCTTGAGG - Intergenic