ID: 1108645783

View in Genome Browser
Species Human (GRCh38)
Location 13:52426228-52426250
Sequence GAGAATAATTAGATGTATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 155}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108645783_1108645784 -4 Left 1108645783 13:52426228-52426250 CCTGCATACATCTAATTATTCTC 0: 1
1: 0
2: 0
3: 10
4: 155
Right 1108645784 13:52426247-52426269 TCTCCTTCCTACTTCTCTCCTGG 0: 1
1: 1
2: 4
3: 66
4: 464

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108645783 Original CRISPR GAGAATAATTAGATGTATGC AGG (reversed) Intronic
901707263 1:11083578-11083600 AAAAAAAATTAGATATATGCAGG + Intronic
908522598 1:64958347-64958369 GAAAATCATTTGATGTATGGTGG - Intronic
910060200 1:83081894-83081916 TGGAAGAATTAGATGTATGATGG + Intergenic
912618784 1:111134265-111134287 GAGAATAATTTCATGTTTGAAGG + Intronic
913677400 1:121154030-121154052 GAGTATAATTTGCTGTATGGAGG + Intergenic
914029236 1:143941659-143941681 GAGTATAATTTGCTGTATGGAGG + Intergenic
914160214 1:145126291-145126313 GAGTATAATTTGCTGTATGGAGG - Intergenic
917600270 1:176566677-176566699 GAGAATAGTTGGATGTATGTGGG - Intronic
917674012 1:177302155-177302177 GAGAATAATTGGAGATAGGCAGG + Intergenic
918373587 1:183885714-183885736 GAGCATAATTATTTGTTTGCAGG + Intronic
918554914 1:185787264-185787286 GAGAAGAATTAGATTAAGGCTGG + Intronic
920464704 1:206172544-206172566 GAGTATAATTTGCTGTATGGAGG + Intergenic
920892675 1:210006870-210006892 GAAAATAATTAAATATATGGGGG - Intronic
923544694 1:234915450-234915472 GAGATTGATTAGAGGGATGCAGG - Intergenic
1065490625 10:26278416-26278438 GAGAATAATAATATGTATTTAGG - Intronic
1068471273 10:57466861-57466883 AAGAATAATTAAATGTATTTAGG - Intergenic
1068734724 10:60399848-60399870 GATTTAAATTAGATGTATGCTGG - Intronic
1071661506 10:87506763-87506785 GTGAAAAATTAGAAGTAGGCTGG + Intronic
1071794275 10:88988956-88988978 GAGGATAATTAGACGTACGTGGG + Intronic
1072003872 10:91222973-91222995 AAGAATACTTACATGTATGGAGG - Exonic
1072431358 10:95374217-95374239 GAGACTATTTAAATGTATGCTGG + Intronic
1074937173 10:118193018-118193040 GAAAATTATTAGATGTATGTAGG - Intergenic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1080207001 11:29741350-29741372 GACAAAAATTAGATTCATGCTGG - Intergenic
1080207264 11:29744682-29744704 GTAAATAATTAGATGTTGGCTGG + Intergenic
1091026991 11:132150257-132150279 GAGCATAAATAGATAAATGCAGG - Intronic
1093070314 12:14701572-14701594 GATCATAATTAAATGTAGGCAGG + Intergenic
1094217663 12:27961661-27961683 GAGATCCATTAGATGTTTGCAGG + Intronic
1095653223 12:44638363-44638385 GAGGATTCTAAGATGTATGCAGG + Intronic
1097239297 12:57564038-57564060 GAGACAACTCAGATGTATGCAGG - Intronic
1100336102 12:93632058-93632080 GAGAATAGTTACATACATGCTGG - Intergenic
1100574211 12:95874495-95874517 GAGAAGAATGAGATGAATGAAGG + Intronic
1101068125 12:101044580-101044602 GAGAGTAATTAGATAGATCCAGG - Intronic
1105314042 13:19241140-19241162 GAAAATAATTAGATGTGTTTTGG + Intergenic
1107625437 13:42277327-42277349 TAGAATAATCAGATGAAGGCAGG - Intronic
1108645783 13:52426228-52426250 GAGAATAATTAGATGTATGCAGG - Intronic
1109650912 13:65324870-65324892 GAGAATGATTAGATTTATAATGG + Intergenic
1109890829 13:68612194-68612216 GAGACTATTTAGATCTTTGCTGG - Intergenic
1109925191 13:69127688-69127710 GAGAAAATCAAGATGTATGCTGG + Intergenic
1111230145 13:85334696-85334718 GAGAATAATTAAAGGAATCCTGG - Intergenic
1111887294 13:94038589-94038611 GAGAAAACTGAGATTTATGCAGG - Intronic
1112459554 13:99591465-99591487 GAGAATATTCAGATGTTTGTGGG - Intergenic
1112482886 13:99793238-99793260 GGGAATGATTAAATGTATACAGG + Intronic
1112539076 13:100289107-100289129 CAGTATAATTTGATGTATGTGGG + Intronic
1113228992 13:108191820-108191842 GAAAATAATTAAATATATGCAGG + Intergenic
1115018556 14:28646784-28646806 TAGAATAATTTGCTGTATGTAGG - Intergenic
1116925848 14:50636001-50636023 TAGAAGAATTATATGTAGGCCGG - Intronic
1117266180 14:54089468-54089490 GAGAATAATTAGACATGTGAAGG - Intergenic
1117515090 14:56492813-56492835 GAGAATAAGCAGAAGTATGAAGG + Intronic
1120647315 14:87089460-87089482 GAGAATAAAAAGATGGATTCTGG - Intergenic
1120719018 14:87870309-87870331 GAGAGTAATTAAAGGTATGAAGG + Intronic
1122011116 14:98748784-98748806 GAGAAAAATTAGAGCCATGCAGG + Intergenic
1124425863 15:29562075-29562097 GAGGATAATCAGATGGATCCAGG + Intronic
1126508099 15:49431533-49431555 GAAAAAAATTTGATGTATACTGG + Intronic
1127732332 15:61812399-61812421 GAGCTTTATTAGATGTATTCTGG - Intergenic
1135510061 16:23074923-23074945 TAGAATATTTAGCTGAATGCTGG + Intronic
1138269607 16:55685739-55685761 GAAGATATTCAGATGTATGCTGG + Intronic
1144265501 17:13564504-13564526 GAGAAGATTTAAATGTATACAGG - Intronic
1153847365 18:9062089-9062111 CAGAATAATGAGAAGTATGTGGG - Intergenic
1156084041 18:33377738-33377760 GACAAAAATGAGATGGATGCAGG + Intronic
1158953223 18:62516599-62516621 TAGAATAATAAGATTTATGAAGG - Intergenic
1159535805 18:69713288-69713310 GAAAAGATTTAGAAGTATGCAGG + Intronic
1159833108 18:73302875-73302897 GACATAAACTAGATGTATGCTGG - Intergenic
929353330 2:40988086-40988108 GAGAAGAATTAGAAGAATGTAGG - Intergenic
931834162 2:66081645-66081667 GAGAATAAAGAGCTGTCTGCAGG - Intergenic
931839017 2:66129188-66129210 GACACTAATTGGATGTCTGCAGG + Intergenic
933004170 2:76969164-76969186 GAGACTAATTAGCTGTGTGGTGG - Intronic
933370030 2:81402875-81402897 GAGAATAATTTGAAGAATGTTGG - Intergenic
933518433 2:83336394-83336416 AAGATAAATTAGATCTATGCAGG - Intergenic
937948154 2:127360901-127360923 GAGAAAAATTAGGTGGCTGCAGG + Intronic
939311423 2:140482449-140482471 GATAAAAATTACCTGTATGCAGG - Intronic
940236178 2:151513041-151513063 GAGAAGATTTAGTTGGATGCAGG + Intronic
940550840 2:155154378-155154400 AAGAATAATTCGATTTATACTGG - Intergenic
940812852 2:158265245-158265267 GAGAGTAATTATCTGTAAGCAGG - Intronic
942941916 2:181628867-181628889 CAGCATAATTATATGTATCCTGG - Intronic
943157552 2:184203150-184203172 TGGAATAATTAGATGTCTACAGG + Intergenic
1169770721 20:9197139-9197161 GAGAATTATTAGATGCCTCCAGG + Intronic
1178984464 21:37291037-37291059 GAGAACAATTAAAAGTATGGGGG + Intergenic
1180571456 22:16725227-16725249 AAGAATATTTTGAGGTATGCTGG + Intergenic
1184632849 22:45798686-45798708 AAGAAAAATCAGATGCATGCAGG + Intronic
950916577 3:16651973-16651995 GAGAATAATGAAATGTTAGCTGG + Intronic
951142983 3:19189197-19189219 AAGAACAATTAGATTTTTGCTGG - Intronic
951222728 3:20085805-20085827 TAGAAAAATTACATGTAGGCAGG - Intronic
951627110 3:24677799-24677821 GTGAATTTTTAGATATATGCAGG + Intergenic
951811417 3:26704839-26704861 TTAAATAATTAGATGTATGAGGG + Intronic
957106738 3:75899245-75899267 AAGAATATTTTGAGGTATGCTGG - Intergenic
959973779 3:112435757-112435779 GGGAATAATGAGATGTTTGAGGG + Intergenic
960223439 3:115144479-115144501 AAGAGGAATTAGATGTTTGCGGG + Intronic
961394318 3:126576369-126576391 TGGAACAATTAGATATATGCAGG + Intronic
962565420 3:136653314-136653336 GAGAATAATGAGTACTATGCAGG + Intronic
964246751 3:154662658-154662680 GACAATATCTAGGTGTATGCAGG + Intergenic
965476221 3:169158857-169158879 GAGAATAATTAGAGAAGTGCTGG - Intronic
965726683 3:171724533-171724555 TAGAATATTTAAATGGATGCTGG + Intronic
967344281 3:188436692-188436714 GAAAATAATTAGGTGTATAGTGG + Intronic
970701147 4:18740156-18740178 GAGAATATATATATGTATGCAGG - Intergenic
971957207 4:33436333-33436355 AATAATAATTAAATGTCTGCTGG + Intergenic
973738658 4:53898517-53898539 GAGAAAAACTAGATATAGGCCGG + Intronic
975401339 4:73943294-73943316 GTGAATAATTAGATGGATCAGGG - Intergenic
977361370 4:96010603-96010625 GAGAATGATTAGATGGAAGAAGG + Intergenic
977378064 4:96234637-96234659 TTGAATAATTAAATGTATGGTGG + Intergenic
978133112 4:105223696-105223718 GAGAATAATGCCATCTATGCAGG + Intronic
978633047 4:110769184-110769206 GAAAATAATTGGATGTTTTCTGG + Intergenic
978773878 4:112486270-112486292 GAGAATAATTCCATGTATCCAGG - Intergenic
978776357 4:112510169-112510191 GAGAATAATAAGAAGCATGGGGG + Intergenic
983832522 4:172345921-172345943 GAGAATAAATAGTCGTATGGTGG - Intronic
984105567 4:175541271-175541293 GAGGAAAAGTAGATGGATGCTGG - Intergenic
984831030 4:183973665-183973687 GAGAATAATTATATTTACTCAGG - Intronic
987495866 5:18643932-18643954 GAGAATGAGTAGTTGTGTGCAGG - Intergenic
988871356 5:35393797-35393819 GAGAATAATTAAATATATAGTGG - Intergenic
990165112 5:52986309-52986331 GAAAATCATTAGATGTCTTCAGG - Intergenic
991050588 5:62268638-62268660 GAGAAGAATTAGAAGTAGGTAGG + Intergenic
993070117 5:83151139-83151161 TAGAATAATTAGTTGTATTTTGG + Intronic
996799593 5:127388443-127388465 GATAATAATTCTATGTAGGCTGG - Intronic
997023756 5:130033300-130033322 GAGAATAGTTGTATATATGCCGG - Intronic
997549062 5:134736695-134736717 GTGAATGATTAGATGAATGAAGG - Intergenic
1000277842 5:159754739-159754761 TAGAATAACTAGAGGGATGCAGG + Intergenic
1003051206 6:2782637-2782659 GAGAATAGTGAAATGTATGCAGG + Intronic
1004127036 6:12883805-12883827 GAGAATTATGATATGTATGCAGG - Intronic
1005479101 6:26238569-26238591 GACAGTAAGTAGAAGTATGCTGG + Intergenic
1005673307 6:28128883-28128905 GATAATAATTAGCTGGAAGCAGG - Intronic
1008102376 6:47405782-47405804 GAAAAGAATTAGATGAATTCTGG + Intergenic
1009592939 6:65697512-65697534 CAAAATAACTAAATGTATGCAGG + Intronic
1013934730 6:115580295-115580317 GAGAATAATTTCATGTTTGAAGG - Intergenic
1014774947 6:125497774-125497796 GCGAATAATTAAATATATGGAGG - Intergenic
1015041142 6:128720533-128720555 TATAATTATTAGTTGTATGCAGG - Intergenic
1020502723 7:8943442-8943464 GAGCATATTTAGTTGTATGAGGG + Intergenic
1021262566 7:18476388-18476410 GATTATAATTAGATGTATCATGG + Intronic
1021830022 7:24596963-24596985 AAGAAGAATTAGATGTCTGGAGG + Intronic
1024827109 7:53403643-53403665 GAAAATCATTAGAAGTAAGCAGG - Intergenic
1026391249 7:69904579-69904601 TATAATATTTAGATGTCTGCTGG + Intronic
1027751090 7:82148105-82148127 TAGAATAATTAACTTTATGCTGG + Intronic
1031708174 7:125009283-125009305 GACAAGAATTAGATGTAGGGAGG - Intergenic
1031772964 7:125869204-125869226 GAGAAAAATTATATTTAAGCAGG + Intergenic
1031937253 7:127748381-127748403 CAGATTAATCAGGTGTATGCTGG + Intronic
1033729664 7:144164227-144164249 GTGCATATTCAGATGTATGCAGG + Intergenic
1034729451 7:153372349-153372371 GATAATAATTAAATGGCTGCAGG + Intergenic
1036488172 8:9198890-9198912 GAAAATCATTAGATTTTTGCTGG - Intergenic
1042057682 8:64783482-64783504 GAGTATAATGATATGTATGTCGG + Intronic
1043088218 8:75864606-75864628 AAGAGTAAATAGATGTAGGCTGG + Intergenic
1047485316 8:125325353-125325375 GGGATTAATTAGATGAATTCTGG + Intronic
1048587619 8:135790192-135790214 GAGAATAGCTAGATGGGTGCCGG + Intergenic
1048612842 8:136042453-136042475 CAGAATAATTTGATGGATTCTGG + Intergenic
1050187274 9:2987731-2987753 GAAAAGAATTAAATGTCTGCTGG + Intergenic
1052108112 9:24545316-24545338 GGGAATAATTACATCTATGCAGG + Intronic
1052693106 9:31840973-31840995 GAGAATAACTAGATATATTTTGG + Intergenic
1053164884 9:35837296-35837318 GAGAAAAATAAGATGCATGTCGG + Intronic
1053267948 9:36729551-36729573 GAGCATAAATAGATGTATACTGG + Intergenic
1055427324 9:76209938-76209960 GAGAATGAGTAGAAGTTTGCTGG + Intronic
1056246559 9:84701394-84701416 GAGATTAAATAAATGAATGCTGG - Intronic
1058360768 9:104143583-104143605 GAGAACATTAAGATGTATTCTGG + Intergenic
1058840438 9:108902317-108902339 GAGAATACTGAGATGTTTGAGGG - Intronic
1059165874 9:112076018-112076040 GAGATGAATTAGAAGTAGGCAGG + Intronic
1059763776 9:117363852-117363874 GAGAAAAGATAGATGTCTGCCGG - Intronic
1060081109 9:120646255-120646277 GAGAATGAGTAGATGTAAGTAGG - Intronic
1060136940 9:121166617-121166639 GAAAATCATTAGAAGTATGAGGG - Intronic
1185527428 X:790675-790697 GAGAAGAATTGGATGTCTGATGG + Intergenic
1188437970 X:30184596-30184618 GAGAATAATTAGTAGGATGGAGG + Intergenic
1188900131 X:35722134-35722156 GAGAATAAGTATATGAATGGTGG + Intergenic
1188930773 X:36108434-36108456 GTGATTAATTAGATGTAAGAAGG - Intronic
1193744731 X:85262993-85263015 TAGAATTGTTAGATGTATGTAGG + Intronic
1194215095 X:91121124-91121146 GAAAGTAATTAGATATATGTTGG - Intergenic
1195044485 X:101043734-101043756 GAGATGAATTAGATGTTTGAAGG + Intronic
1195385565 X:104310747-104310769 TAGAATAATTATGTGTATTCAGG + Intergenic
1195926098 X:110026379-110026401 GTGAGTAATGAGCTGTATGCTGG + Intronic
1196802420 X:119555778-119555800 GTGAGTGACTAGATGTATGCAGG + Intronic
1201914647 Y:19169072-19169094 GAGACTAATTAGTGGTATGTGGG + Intergenic