ID: 1108648051

View in Genome Browser
Species Human (GRCh38)
Location 13:52450208-52450230
Sequence GCTCCCGGAAGCATTCCGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 59}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108648041_1108648051 22 Left 1108648041 13:52450163-52450185 CCCGCAGACGGCGAGCGCTCCTT 0: 1
1: 0
2: 0
3: 4
4: 35
Right 1108648051 13:52450208-52450230 GCTCCCGGAAGCATTCCGGGCGG 0: 1
1: 0
2: 0
3: 7
4: 59
1108648039_1108648051 29 Left 1108648039 13:52450156-52450178 CCCGGCGCCCGCAGACGGCGAGC 0: 1
1: 0
2: 0
3: 14
4: 89
Right 1108648051 13:52450208-52450230 GCTCCCGGAAGCATTCCGGGCGG 0: 1
1: 0
2: 0
3: 7
4: 59
1108648046_1108648051 -3 Left 1108648046 13:52450188-52450210 CCCGGGCACTGCAGCTGTGCGCT 0: 1
1: 0
2: 2
3: 21
4: 245
Right 1108648051 13:52450208-52450230 GCTCCCGGAAGCATTCCGGGCGG 0: 1
1: 0
2: 0
3: 7
4: 59
1108648045_1108648051 3 Left 1108648045 13:52450182-52450204 CCTTCTCCCGGGCACTGCAGCTG 0: 1
1: 0
2: 0
3: 31
4: 300
Right 1108648051 13:52450208-52450230 GCTCCCGGAAGCATTCCGGGCGG 0: 1
1: 0
2: 0
3: 7
4: 59
1108648040_1108648051 28 Left 1108648040 13:52450157-52450179 CCGGCGCCCGCAGACGGCGAGCG 0: 1
1: 0
2: 1
3: 5
4: 63
Right 1108648051 13:52450208-52450230 GCTCCCGGAAGCATTCCGGGCGG 0: 1
1: 0
2: 0
3: 7
4: 59
1108648047_1108648051 -4 Left 1108648047 13:52450189-52450211 CCGGGCACTGCAGCTGTGCGCTC 0: 1
1: 0
2: 5
3: 22
4: 219
Right 1108648051 13:52450208-52450230 GCTCCCGGAAGCATTCCGGGCGG 0: 1
1: 0
2: 0
3: 7
4: 59
1108648042_1108648051 21 Left 1108648042 13:52450164-52450186 CCGCAGACGGCGAGCGCTCCTTC 0: 1
1: 0
2: 0
3: 2
4: 41
Right 1108648051 13:52450208-52450230 GCTCCCGGAAGCATTCCGGGCGG 0: 1
1: 0
2: 0
3: 7
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108648051 Original CRISPR GCTCCCGGAAGCATTCCGGG CGG Intronic