ID: 1108648160

View in Genome Browser
Species Human (GRCh38)
Location 13:52450612-52450634
Sequence GCTCGCGGCCTCGGAGGGCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 177}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108648160_1108648172 19 Left 1108648160 13:52450612-52450634 CCCGGCCCTCCGAGGCCGCGAGC 0: 1
1: 0
2: 0
3: 10
4: 177
Right 1108648172 13:52450654-52450676 GGCGCCCCCTAGCGTCGGACGGG 0: 1
1: 0
2: 0
3: 3
4: 38
1108648160_1108648171 18 Left 1108648160 13:52450612-52450634 CCCGGCCCTCCGAGGCCGCGAGC 0: 1
1: 0
2: 0
3: 10
4: 177
Right 1108648171 13:52450653-52450675 CGGCGCCCCCTAGCGTCGGACGG 0: 1
1: 0
2: 0
3: 6
4: 27
1108648160_1108648170 14 Left 1108648160 13:52450612-52450634 CCCGGCCCTCCGAGGCCGCGAGC 0: 1
1: 0
2: 0
3: 10
4: 177
Right 1108648170 13:52450649-52450671 CCTGCGGCGCCCCCTAGCGTCGG 0: 1
1: 0
2: 0
3: 5
4: 47
1108648160_1108648167 -2 Left 1108648160 13:52450612-52450634 CCCGGCCCTCCGAGGCCGCGAGC 0: 1
1: 0
2: 0
3: 10
4: 177
Right 1108648167 13:52450633-52450655 GCAGCGCGCCAGGCAGCCTGCGG 0: 1
1: 0
2: 3
3: 20
4: 269
1108648160_1108648174 23 Left 1108648160 13:52450612-52450634 CCCGGCCCTCCGAGGCCGCGAGC 0: 1
1: 0
2: 0
3: 10
4: 177
Right 1108648174 13:52450658-52450680 CCCCCTAGCGTCGGACGGGACGG 0: 1
1: 0
2: 0
3: 0
4: 21

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108648160 Original CRISPR GCTCGCGGCCTCGGAGGGCC GGG (reversed) Exonic
900227365 1:1539585-1539607 GCTCGCGGCCTGCGTGGGGCTGG + Intronic
900386468 1:2413121-2413143 GCTCGGGGCCTGGAAGGTCCCGG - Intronic
900945110 1:5826664-5826686 GCACCCTGCCTCGGTGGGCCTGG + Intergenic
901207624 1:7505908-7505930 CCTCTCGGACTGGGAGGGCCAGG - Intronic
902605285 1:17565718-17565740 GCTCCTGGCCTCGGAGAGCTCGG + Intronic
903034543 1:20485683-20485705 GCTCGCGGCCCCGCCCGGCCCGG - Exonic
903349749 1:22710703-22710725 GCGCGCGGCCGCCGGGGGCCGGG + Intergenic
903522224 1:23959562-23959584 GGCCGGGGCCTCGGCGGGCCAGG + Intronic
903647584 1:24904475-24904497 GCTCTCGGCCTCAAGGGGCCGGG - Intronic
904236609 1:29121290-29121312 GCTCGGGGACTCCTAGGGCCGGG + Exonic
905553163 1:38859789-38859811 GCTCGGGGCCTATGAGAGCCGGG - Exonic
905626232 1:39491981-39492003 GCGCGCGGCCATGGCGGGCCGGG - Exonic
910839271 1:91546292-91546314 CCTCGAGTCCTCGCAGGGCCGGG + Intergenic
911348331 1:96722368-96722390 TCTCCCGACCACGGAGGGCCGGG - Intronic
916497169 1:165356464-165356486 GCCCTCGGCTTCGGAGCGCCGGG + Exonic
919748745 1:201023859-201023881 GCTCGCGGCCACGGGGTGGCTGG + Intergenic
920267526 1:204735094-204735116 GCTTGGGACCTGGGAGGGCCTGG - Intergenic
920394208 1:205631944-205631966 GGCGGCGGCCGCGGAGGGCCTGG - Exonic
921934732 1:220786389-220786411 GCTCGCCGGCGCGGAGGGCCTGG + Intergenic
921944975 1:220880028-220880050 GGGGGCGGCCCCGGAGGGCCTGG + Exonic
922155701 1:223038494-223038516 GCTCGGGGCTTCGTTGGGCCCGG + Intergenic
922787406 1:228289818-228289840 GCTCGGGGCCTTGAAGGGCCTGG + Intronic
922851265 1:228735698-228735720 GGTCGCGGGCTAGCAGGGCCCGG - Exonic
1065902967 10:30224551-30224573 GCTCCTGCCCTCAGAGGGCCAGG - Intergenic
1068669651 10:59710001-59710023 GCTCCAGGCCTGGTAGGGCCGGG - Exonic
1075037362 10:119080568-119080590 GCTCTCGACCTCGGAGGCCTCGG + Intronic
1075693658 10:124418475-124418497 GCTCGCGGCCTGTGGAGGCCAGG - Intronic
1075801700 10:125158963-125158985 GCCCGCGGCCTCCGAGCCCCAGG + Intronic
1076475931 10:130751432-130751454 GCACGAAGCCTCGCAGGGCCTGG + Intergenic
1076655625 10:132021723-132021745 GCTCGGGGCCTGGGAGGGCTGGG + Intergenic
1076882977 10:133248469-133248491 GCTCGCGGGCTCTGTGGCCCGGG - Intergenic
1076919917 10:133446122-133446144 GCTCGTGCCCTCGGGGGTCCTGG - Intergenic
1077299102 11:1839045-1839067 TCCCCCGGCCTCGGCGGGCCGGG - Intronic
1078091669 11:8268164-8268186 GCTGGCGGCCTCGTTGGGACCGG + Intronic
1079034024 11:17007031-17007053 ACTCCCTGCCTCGGAGGACCAGG + Intronic
1081845554 11:46238205-46238227 TCTGGCCGCCTCGGAGGGCAGGG + Intergenic
1084385804 11:68841978-68842000 GCCCGGGGCCTCGGCGGGGCGGG + Intronic
1084590115 11:70085526-70085548 GCTCACCACCTGGGAGGGCCTGG - Intronic
1088604181 11:111512707-111512729 GCTCCCGGCCTGGGAGGGCGCGG + Intergenic
1088847762 11:113682218-113682240 GTTCTGGGCCTAGGAGGGCCAGG + Intergenic
1090204358 11:124876465-124876487 GCTCCCGGCCTCGGAGCGGACGG + Intronic
1091730388 12:2876657-2876679 GCCCGCGGCCTCGGGAGGGCTGG - Intronic
1094838606 12:34333758-34333780 GTTCACGCCCACGGAGGGCCTGG + Intergenic
1094843038 12:34349896-34349918 GCTCGCGCCCTCGGAGCAGCTGG - Intergenic
1096250036 12:50025195-50025217 GGACGCGGCCTGGGAGGGTCGGG - Intronic
1096862862 12:54542474-54542496 TCTCAGGGCCTCAGAGGGCCTGG + Intronic
1097029393 12:56080436-56080458 GCGCGCAGCCTCGGAGGGTATGG + Intronic
1104367529 12:128191485-128191507 GATCTCGGTCTCGGGGGGCCGGG - Intergenic
1104992851 12:132635798-132635820 GCTCAGGGCCCCGGCGGGCCTGG - Intronic
1105492583 13:20902863-20902885 CGTCGCGGCCTCGGCGGGTCTGG + Intronic
1108648160 13:52450612-52450634 GCTCGCGGCCTCGGAGGGCCGGG - Exonic
1113737747 13:112690294-112690316 GGTCACGGCCTCGGCGCGCCGGG - Intergenic
1122275165 14:100587339-100587361 GCGCTCGGCCTCGGAGGGGAGGG - Intronic
1122418358 14:101560928-101560950 GCCCGCGTCCTCGGTGGGGCGGG + Intergenic
1122775862 14:104116790-104116812 GCTCGGGCGCACGGAGGGCCCGG - Intergenic
1122981697 14:105195116-105195138 GCTCACGGGCACGGTGGGCCTGG - Intergenic
1124690800 15:31820952-31820974 GCTGGGGGCCTCGGAGGGAATGG - Intronic
1128161046 15:65422977-65422999 GGGCGCGGCCTCGGGGGCCCGGG + Exonic
1129676030 15:77632779-77632801 GGTCCCGGCCCCGGAGGGCGCGG - Intronic
1129763014 15:78142563-78142585 GCTCCTAGCCTCTGAGGGCCTGG - Intronic
1131144292 15:90001568-90001590 GCTGGGGCCCTCGGCGGGCCGGG - Exonic
1132907241 16:2289000-2289022 GCTCTCTGTCTCGGAGGACCAGG - Intronic
1134656212 16:15949902-15949924 GCTGCCGGCCTCGGGGGCCCGGG + Intronic
1134690838 16:16190235-16190257 GCTCCTGGCCTCGGATGCCCAGG + Exonic
1135382740 16:22008148-22008170 GCTCGCGCCCTCCGCGCGCCCGG - Intronic
1136261809 16:29082336-29082358 ACTCGGGGCCGCGGCGGGCCGGG + Intergenic
1141671105 16:85492087-85492109 ACCCGCTGCCTCGGAGGGGCGGG - Intergenic
1142312536 16:89322488-89322510 GCACGTGGCCTCAGAGGCCCAGG + Intronic
1143521542 17:7446972-7446994 GCGCGGGGCCTCGGGGGGCGGGG + Intronic
1144626349 17:16846191-16846213 GGTGGCTGCCTGGGAGGGCCTGG - Intergenic
1144880083 17:18426528-18426550 GGTGGCTGCCTGGGAGGGCCTGG + Intergenic
1145059696 17:19724813-19724835 GCTCGCCGCCCCTGAGGGGCTGG - Intergenic
1145152150 17:20517856-20517878 GGTGGCTGCCTGGGAGGGCCTGG - Intergenic
1145833703 17:27937773-27937795 GCTGGGGGCCTGGGATGGCCTGG - Intergenic
1147397455 17:40155576-40155598 GCCCGTGGCCTCGGAGGAGCCGG + Intronic
1147580495 17:41624889-41624911 GGTGGCTGCCTGGGAGGGCCTGG - Intergenic
1147643576 17:42020158-42020180 CCCCGCGAGCTCGGAGGGCCCGG + Intronic
1149682853 17:58517831-58517853 GAGCGCGGCCTCAGAGGGTCGGG - Exonic
1150414538 17:64976113-64976135 GGTCTCGGCCTCGGAGCGCCAGG - Intergenic
1150692784 17:67378996-67379018 GCTCGCGGCTTCGCAGGATCGGG - Intronic
1150797092 17:68247490-68247512 GGTTTCGGCCTCGGAGCGCCAGG + Intergenic
1151598290 17:75091088-75091110 CCTCGGGGCCTGGGAGTGCCAGG + Intronic
1152175014 17:78781913-78781935 GCTCGCGGTCTCGCGGGGCCAGG - Intronic
1152584157 17:81181701-81181723 GCTGGCGGCCACGGAGGGGTGGG + Intergenic
1152745635 17:82037411-82037433 GCTCGCCGCCTCGCAGCGCTGGG + Intronic
1152932375 17:83116379-83116401 CCTCGAGGCCTCGTGGGGCCGGG + Intergenic
1153149099 18:2069881-2069903 GGCCAGGGCCTCGGAGGGCCAGG - Intergenic
1154156531 18:11948137-11948159 GCTCGCGGCCTCGGTGAGGCTGG - Intergenic
1156350454 18:36297710-36297732 GCTCGCGGACTCGCAGGCTCAGG - Intronic
1158538378 18:58329094-58329116 GCCCGAGCCCTCGGAGGGCGGGG + Exonic
1160179174 18:76619523-76619545 TCCCTCGGCCTTGGAGGGCCTGG + Intergenic
1160496503 18:79379114-79379136 AATCGCGCCCTCGCAGGGCCGGG - Intergenic
1161309395 19:3585660-3585682 GCCCGCGCCCTCGGAGCCCCCGG + Exonic
1161498257 19:4598852-4598874 GCTCGGGGCCTTGGGGAGCCTGG - Intergenic
1161672793 19:5623490-5623512 GTTCGCGGCCTCGCCGGACCTGG + Intronic
1161741042 19:6021456-6021478 GGTCGCCGCCACGGAGGGACTGG + Intronic
1162124967 19:8494477-8494499 GCTGACAGCCTCAGAGGGCCTGG - Intronic
1162948532 19:14057535-14057557 GCTCGCTGCCTCGGGAGCCCCGG - Intronic
1163230964 19:16001959-16001981 GATCGGAGCCTCGGGGGGCCAGG - Intergenic
1163862151 19:19748136-19748158 GCTCCCAGCCTGGAAGGGCCAGG + Intergenic
1166894890 19:46016912-46016934 GCGGGCGGGCTGGGAGGGCCTGG + Intronic
1168145700 19:54419139-54419161 GGTGGCGGCCTTGGCGGGCCTGG + Exonic
925398966 2:3558294-3558316 GCTCGCGCCCACGCTGGGCCGGG - Exonic
926077129 2:9951038-9951060 GCGCGCGGCCGCGGTGGGCCAGG + Intergenic
934765805 2:96879423-96879445 CCTGGCGCCCTGGGAGGGCCGGG - Intronic
936403249 2:112181980-112182002 GCGCGCGGTCTCAGAAGGCCTGG + Intronic
942459571 2:176159916-176159938 GCTCCAGGCCTCGAAGGACCAGG + Intronic
948465082 2:238148400-238148422 CCTCGAGGCCTCGGAGGTCGGGG - Intronic
1168804455 20:664223-664245 GCTCGCGGCGGCGGCGGGGCGGG - Exonic
1169131406 20:3168010-3168032 GCTCGCCGCCTCGGGGCGCCTGG - Intronic
1170999278 20:21396851-21396873 GCGCGCGGCTTAGGAGGTCCTGG - Intronic
1171035412 20:21709327-21709349 GCAGGCGGCCACGGCGGGCCCGG - Exonic
1172482224 20:35277836-35277858 GCCTGCGGCGCCGGAGGGCCCGG - Intergenic
1173576512 20:44115835-44115857 GCTCGGGGCCTCGGAGCGTGGGG + Exonic
1176031459 20:63015018-63015040 GCTCACAGCCTCTGAGGTCCCGG + Intergenic
1176171501 20:63698365-63698387 CCTCGAGGCCCCGGAGGGCTGGG + Exonic
1179746195 21:43445387-43445409 GGTCGCGGACTTGGAGGCCCAGG + Intergenic
1179914495 21:44467530-44467552 GCTCGCGGCTTCAAAGGGTCTGG + Intergenic
1181695928 22:24592813-24592835 GCTGGCGGCCAGGGAGGGTCTGG - Intronic
1182282275 22:29224520-29224542 GCTGGCTGCCTGGGAGGGCAAGG - Intronic
1183517132 22:38273037-38273059 GCTCGCCGCCGGGGAGGGCGGGG + Intergenic
1183649426 22:39145591-39145613 GCTCGCGGCGCCGGCGGGGCGGG + Intronic
1183856121 22:40636371-40636393 GCGCGCGTCCTCGGGGGGTCGGG - Intronic
1184265388 22:43343424-43343446 GCCCGTGGCGTCGGAGGGGCGGG + Intergenic
1184457303 22:44618510-44618532 GCTCTGGGCCTCGGGGAGCCCGG - Intergenic
1185082562 22:48718048-48718070 GCTCGTGGCCTTGCATGGCCAGG + Intronic
1185266524 22:49906972-49906994 GCTGGGGGCCTGGCAGGGCCTGG - Intronic
950028253 3:9835105-9835127 GCTGGGGGCCTCGGAGGCACAGG - Exonic
950902801 3:16512968-16512990 GCGCGCGGCCTGGGTGGGGCAGG - Intronic
954446111 3:50547720-50547742 GCTCAGGGCCTAGGAGGGCTGGG - Intergenic
954575186 3:51671827-51671849 GTGCGCGGCGGCGGAGGGCCGGG - Exonic
954662454 3:52233288-52233310 GGCCGAGGCCTCAGAGGGCCTGG - Intronic
954684589 3:52363513-52363535 GCTGGGAGGCTCGGAGGGCCTGG - Intronic
956414619 3:69013363-69013385 GCCCGGGGCCGGGGAGGGCCAGG + Intronic
968224857 3:196967217-196967239 GCTCGCTGAGTCCGAGGGCCTGG + Intronic
968507391 4:977170-977192 CCTCGCAGCCTCGGAGGAGCCGG + Intronic
968556773 4:1249594-1249616 GCCCGCGGCCTCGGTGCCCCTGG - Intronic
968608004 4:1544653-1544675 CCTCGCAGCCTCGGAGGAGCCGG + Intergenic
968645808 4:1740010-1740032 GCACGTGGCCTCGGTGGCCCGGG - Intronic
968890216 4:3364831-3364853 GGTCGCTGCCTGGGAGAGCCAGG + Intronic
969461077 4:7329229-7329251 GCCCGGGGCCTGGGAGGGCATGG + Intronic
970405239 4:15756716-15756738 CCTAGCGGCCTCGGAGGGTGAGG + Intergenic
971519526 4:27531497-27531519 GCTCTGGGACTGGGAGGGCCCGG + Intergenic
978795712 4:112705900-112705922 ACTCGGGGCCGCGGCGGGCCGGG - Intergenic
982042196 4:151408146-151408168 GCAGGCGGCCGCGCAGGGCCGGG + Intergenic
982202862 4:152975906-152975928 GCTCCCGGGCTTGGAGGCCCCGG - Exonic
984146333 4:176065913-176065935 GCCCGCGGGCTCCGAGGGGCGGG - Intronic
984765721 4:183398925-183398947 GCCCGCGGCCGCGGCGGACCCGG - Intergenic
985769429 5:1799632-1799654 CCTGGCGGTCTCAGAGGGCCAGG - Intronic
986449490 5:7850759-7850781 GCGGGCGGCCGCGGAGGGGCGGG - Intronic
995324129 5:110872432-110872454 GCCGGCTGCCTCGCAGGGCCAGG - Intergenic
996790617 5:127290136-127290158 GCGCGAGGCCTCCGAGGACCTGG + Intergenic
997120096 5:131164915-131164937 GCAGGCCGCCTCGGAGTGCCCGG + Intronic
1002080377 5:176733861-176733883 CCCCGCGGCCTTGGAGGGTCCGG + Intergenic
1002385098 5:178860390-178860412 CCTCGCGGACTCGGGGCGCCGGG + Intronic
1006309705 6:33249130-33249152 GCTCGCGGCCCCTCAGAGCCTGG + Intergenic
1006840000 6:37022522-37022544 GGTGGAGGCCTCGGAGGGACAGG - Intronic
1007927743 6:45663556-45663578 GCTCGCCGCAGCGGCGGGCCGGG - Intronic
1015604787 6:134943660-134943682 GCTCCAGGCCTGGGAAGGCCAGG - Intronic
1019508198 7:1403979-1404001 GCTTGCGGCCGCGGCTGGCCGGG - Intergenic
1021365388 7:19772573-19772595 GCTTGTGCTCTCGGAGGGCCAGG + Exonic
1025129551 7:56368339-56368361 TCTCTCGGCCTGGGAGGGGCCGG + Intergenic
1026785751 7:73300706-73300728 TCACGGGGCCTCAGAGGGCCAGG - Intergenic
1027108314 7:75419230-75419252 TCACGGGGCCTCAGAGGGCCAGG + Intronic
1028987715 7:97021277-97021299 GGTCGTGGCCTCGCTGGGCCGGG - Intronic
1029715094 7:102321404-102321426 GCCGGCGGCGTCGGAGGGCGAGG - Exonic
1029736750 7:102469458-102469480 CCTCCCCGCCTCGGAGGGGCTGG + Intronic
1034342620 7:150368335-150368357 GCTTGCGGCCGCGGCGGTCCCGG - Intronic
1034528894 7:151683328-151683350 GCTTGGGGCTTCTGAGGGCCAGG - Intronic
1035205520 7:157291716-157291738 GCGCGCGGTCTCTGAAGGCCTGG - Intergenic
1036454189 8:8893375-8893397 GCGCGGCGCCTCGGGGGGCCCGG + Exonic
1037963986 8:23119199-23119221 GCACTCGGCCTCGGAGCTCCTGG + Intergenic
1039554898 8:38468438-38468460 GCTCGCGGCCGGGGAAGGCGAGG + Intronic
1041449780 8:57994590-57994612 ACGCGCGGCCGCGAAGGGCCCGG - Exonic
1042837322 8:73090541-73090563 GCTCTCACCCTCGGAGGGGCAGG + Intronic
1045583116 8:103500431-103500453 GCGCGCCGCCTCGGAGGGGAAGG - Intergenic
1048861391 8:138726807-138726829 GCCCGTGGCCTCTGAGGTCCTGG - Intronic
1053003368 9:34589871-34589893 GCGCGCGGCCGCGGAGGCGCGGG - Intronic
1060176282 9:121499606-121499628 GCTCGTGGCCTCCGGGGACCTGG + Intergenic
1061089888 9:128420677-128420699 GCCCGGGGCACCGGAGGGCCAGG - Exonic
1061486891 9:130924603-130924625 CCTCGAGGGCTGGGAGGGCCGGG + Intronic
1062541361 9:137043101-137043123 GCTCACGGCCCCGCAGGGCTCGG + Intronic
1185520429 X:734524-734546 GGTGGCGGCCTCGGGGGTCCTGG - Intergenic
1189821396 X:44873016-44873038 GGTGGCGGCCTCGGTGGGCGGGG + Intergenic
1190533968 X:51407877-51407899 AATCGCGGCCTCGGCGGGCAGGG - Exonic
1190618401 X:52262027-52262049 GCTCGCGACCGCTGAAGGCCAGG + Intergenic
1192034118 X:67545262-67545284 GCTCGCGGCCTCTGGGTGCCTGG - Exonic
1200161789 X:154013365-154013387 GCTGGCGGCCTCCGAATGCCCGG + Exonic