ID: 1108651820

View in Genome Browser
Species Human (GRCh38)
Location 13:52488743-52488765
Sequence ACTGGAAGCCAGAGCCTAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108651818_1108651820 10 Left 1108651818 13:52488710-52488732 CCTTCTGAGGCTTGTCATCTAGA No data
Right 1108651820 13:52488743-52488765 ACTGGAAGCCAGAGCCTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108651820 Original CRISPR ACTGGAAGCCAGAGCCTAAA TGG Intergenic
No off target data available for this crispr