ID: 1108659986

View in Genome Browser
Species Human (GRCh38)
Location 13:52576484-52576506
Sequence CACTGTGAACAGCTTGCCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108659984_1108659986 2 Left 1108659984 13:52576459-52576481 CCTTGAAGATAGATTCAAGGAGA No data
Right 1108659986 13:52576484-52576506 CACTGTGAACAGCTTGCCCTAGG No data
1108659982_1108659986 18 Left 1108659982 13:52576443-52576465 CCAGAGCTCTTCAACTCCTTGAA No data
Right 1108659986 13:52576484-52576506 CACTGTGAACAGCTTGCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108659986 Original CRISPR CACTGTGAACAGCTTGCCCT AGG Intergenic
No off target data available for this crispr