ID: 1108667239

View in Genome Browser
Species Human (GRCh38)
Location 13:52644946-52644968
Sequence GGTGCTTAATAATCTAGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 77}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108667239_1108667244 28 Left 1108667239 13:52644946-52644968 CCAACACTAGATTATTAAGCACC 0: 1
1: 0
2: 2
3: 10
4: 77
Right 1108667244 13:52644997-52645019 TCCCTCGCATATCTATACATAGG 0: 1
1: 0
2: 0
3: 3
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108667239 Original CRISPR GGTGCTTAATAATCTAGTGT TGG (reversed) Intergenic