ID: 1108668686

View in Genome Browser
Species Human (GRCh38)
Location 13:52658867-52658889
Sequence ACTTATCAACAGAAACAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 2, 1: 1, 2: 1, 3: 33, 4: 323}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108668686 Original CRISPR ACTTATCAACAGAAACAAGA TGG (reversed) Intronic
901094559 1:6667809-6667831 ACCTATGCACAGAATCAAGATGG + Exonic
904396036 1:30223160-30223182 ACGTATTAACAGAAACAAAAGGG - Intergenic
905496643 1:38394365-38394387 AATTATCCAAAGAAACTAGAGGG + Intergenic
907800475 1:57760182-57760204 ACTTATGCACAGGAACAACATGG + Intronic
909082163 1:71125551-71125573 ACTTCTCAAAAGAAACCATATGG - Intergenic
909154118 1:72049063-72049085 ACATTTAAACAGAAACTAGAAGG + Intronic
909879500 1:80855675-80855697 ACTTGTCAAAAGAAACCATAAGG + Intergenic
910295390 1:85639577-85639599 AATTATCAAGAGAAAAATGAAGG + Intergenic
911850904 1:102819101-102819123 AATAATCAACAGAACCAAGCAGG - Intergenic
912215057 1:107600219-107600241 ACAAATGAACAGAAACAAAATGG + Intronic
915383066 1:155461486-155461508 TCTTAACAACAGATACAAGATGG + Intronic
916320691 1:163500054-163500076 ACTGATCAAGAGAAAAAAGAGGG - Intergenic
917742343 1:177972857-177972879 CCTTATAAAAAGACACAAGAGGG + Intronic
920064025 1:203252525-203252547 AATTATCAAAAGAAAAAAGGGGG - Intronic
921405016 1:214769204-214769226 ACTGATGACCAGAAACAGGAGGG - Intergenic
922136696 1:222835138-222835160 ACAATTCAACAGAAATAAGATGG - Intergenic
923931955 1:238711025-238711047 AGTTATTTACAGAAACCAGAAGG - Intergenic
924101925 1:240612409-240612431 ATTTCTCTACATAAACAAGAAGG - Intergenic
1063243310 10:4193274-4193296 ACTTCCAAACAGAAACACGAGGG - Intergenic
1063781384 10:9329253-9329275 GCTTATAAACAGAAGCAATAAGG - Intergenic
1064233426 10:13550513-13550535 ACTTCTCATCAGAAACAACAGGG + Intergenic
1065672615 10:28137137-28137159 ACTTCTCATCAGAAACAATGTGG + Intronic
1067064973 10:43098965-43098987 AGTTATCATGAAAAACAAGAAGG - Intronic
1067232616 10:44422732-44422754 AATTCTCAACAGAAAGAGGAGGG - Intergenic
1068009452 10:51429637-51429659 AATTATCAAAAGAAACAAATGGG + Intronic
1068346466 10:55785695-55785717 AATTATCTAGAGAAACAATATGG + Intergenic
1069186304 10:65428019-65428041 ATTTATCATCGGAGACAAGAAGG - Intergenic
1070569334 10:77629345-77629367 ACTGATCAAGAGAAACCAGGTGG + Intronic
1071029693 10:81161892-81161914 ACTTGTCAACAGACAGAATATGG - Intergenic
1072016720 10:91354530-91354552 AAGTATCAACATACACAAGATGG - Intergenic
1075542000 10:123321742-123321764 ACATAAAAAAAGAAACAAGAAGG - Intergenic
1076226171 10:128778129-128778151 AATTATTAACATTAACAAGAAGG + Intergenic
1076490048 10:130852948-130852970 ACTTAGCAACATAATCAAGGAGG - Intergenic
1077671859 11:4165127-4165149 AATTATAGAAAGAAACAAGATGG + Intergenic
1080988055 11:37494730-37494752 AATCATCATCATAAACAAGAAGG + Intergenic
1082859845 11:57845225-57845247 ACTTATCTAAAAAAAAAAGAAGG + Intergenic
1085183869 11:74559059-74559081 AGTTATTAACAGAAAGAATAGGG + Intronic
1085432979 11:76471954-76471976 ACATATGAACAGAAACCAGAAGG - Intronic
1085845564 11:80060710-80060732 ACATATGAACAGAAGCAGGAGGG + Intergenic
1086148063 11:83576583-83576605 GCTTCTCATCAGAAACAACATGG + Intronic
1086616416 11:88826259-88826281 ACTTACCAAAATAAAAAAGATGG + Intronic
1087375138 11:97330155-97330177 ACTTAGCCACAAAAAGAAGAAGG - Intergenic
1087696811 11:101388234-101388256 ACTTATCAATAGCAACACAATGG - Intergenic
1087970167 11:104471087-104471109 ACTTACCAACATAAAGAAGTGGG + Intergenic
1088996625 11:115005911-115005933 ACATATCCACAGCAACAAGCTGG + Intergenic
1089570431 11:119404533-119404555 ACTAATTAAGAGAAACAAGAAGG - Intergenic
1092051056 12:5470543-5470565 ACTTAGCAACAGGAACTACACGG - Intronic
1092378315 12:7974045-7974067 AATTCTAAACAGAAACAAGTGGG + Intergenic
1092830485 12:12439809-12439831 ACTCACCAACAGAGATAAGACGG - Intronic
1093683904 12:22034500-22034522 TCTTATTAACAGAAATAAAAAGG + Intergenic
1094165655 12:27440151-27440173 ACCTCTCAACAGAAACCACAGGG + Intergenic
1094683645 12:32688497-32688519 ACTTCTCATCAGAAACCATAGGG - Intronic
1094777037 12:33741872-33741894 ACTTAACAACAGAAATACAAAGG + Intergenic
1097346477 12:58498919-58498941 ACTGACCAGCAGAAACAAGGAGG + Intergenic
1098910845 12:76206907-76206929 ACTTATCAAAAGAAACAGGCTGG - Intergenic
1099033325 12:77556028-77556050 ACATATCAAAAGAAACAATTTGG - Intergenic
1099340687 12:81429796-81429818 TCTTATCAACTGAAACAACATGG - Intronic
1099600914 12:84736362-84736384 ATTTATGGACACAAACAAGAAGG - Intergenic
1099934265 12:89106980-89107002 ATTTTTCAAAGGAAACAAGATGG + Intergenic
1100116397 12:91310497-91310519 CCTTCTCAGCATAAACAAGATGG + Intergenic
1101429792 12:104617317-104617339 ACTTTTCACAAGAAACAAGGAGG + Intronic
1103181908 12:118920177-118920199 ACCTATAAAAAGGAACAAGAAGG - Intergenic
1103964977 12:124632875-124632897 TCTTATCTACTGAGACAAGAAGG - Intergenic
1104207240 12:126651006-126651028 ACTTCTCAAAAGAAAGAAGCAGG - Intergenic
1106533329 13:30616259-30616281 AATTAGTAACAGAAACAAAATGG - Intronic
1106788899 13:33134638-33134660 ATTTATCAACAGAACCAAATGGG + Intronic
1107494464 13:40912103-40912125 ACTTATCAACAGAAACAAGATGG + Intergenic
1107614445 13:42150214-42150236 ACTGTTCAACAGAAATAAAAAGG - Intronic
1108668686 13:52658867-52658889 ACTTATCAACAGAAACAAGATGG - Intronic
1110691984 13:78441652-78441674 ATTTATTAATAGAAACAATAAGG + Intergenic
1112651734 13:101406399-101406421 ACTTAGGCACAGAGACAAGACGG + Intronic
1112903430 13:104388070-104388092 ACTTAGCAAGAGAAAAAAAATGG - Intergenic
1112916610 13:104558783-104558805 ACTTATGAACACAAAGAAGGAGG - Intergenic
1113076124 13:106469565-106469587 ACTTACCAAGAGAAACAGGCTGG - Intergenic
1113726626 13:112608268-112608290 TCTGAACAACAGAAAGAAGATGG + Intergenic
1113729813 13:112633193-112633215 ACTCCTCATCAGAAACAACAAGG + Intergenic
1114028475 14:18553217-18553239 ACTTCTCATCAGAAACAATGTGG - Intergenic
1114719294 14:24863033-24863055 AATTATCAACAGAATAAAGAAGG - Intronic
1114743977 14:25126755-25126777 ACCTATCAAAAAGAACAAGATGG - Intergenic
1115215738 14:31012412-31012434 TCTTAACAACAGCAACAAAAAGG + Intronic
1116431082 14:44845835-44845857 ACTCACCAACAGAAACAAAAGGG + Intergenic
1116566020 14:46445252-46445274 AAGAATCAACAGAGACAAGATGG - Intergenic
1117124592 14:52608766-52608788 ACTTCTCAGCAGAAACATTACGG - Intronic
1121006574 14:90494492-90494514 TTTTATCATCAGAAACAAGGTGG - Intergenic
1123917768 15:25049543-25049565 ACTTATTGACAAAAACAAGAAGG + Intergenic
1124378353 15:29143091-29143113 GCTGATCCACAGAAATAAGATGG + Intronic
1125064819 15:35469819-35469841 ACATATAAACTGAAAGAAGAGGG + Intronic
1125402082 15:39314910-39314932 AATGATCATCAGAAATAAGATGG + Intergenic
1125530774 15:40412058-40412080 CCTTGACAACAGAAGCAAGAAGG + Intronic
1127087389 15:55437188-55437210 ACTTAACAACAGAAATCAGGAGG - Intronic
1127167621 15:56263429-56263451 ATTTAAAAACAGAAACAAAATGG - Intronic
1127312017 15:57760781-57760803 TCTTTCCTACAGAAACAAGAAGG - Intronic
1128934306 15:71732275-71732297 TATTATTAACAGAAACAAAAGGG - Intronic
1129645795 15:77431116-77431138 ACTTGTCAACAGAAATAATGGGG + Intronic
1130217251 15:81984071-81984093 ACTCATGCTCAGAAACAAGATGG - Intergenic
1130290500 15:82595945-82595967 ACCAATTAACAGAAACTAGAGGG + Intronic
1131457620 15:92595649-92595671 ACAGATCCACAGAAAAAAGAAGG + Intergenic
1132923095 16:2410168-2410190 ACTCATCTACAGAACCTAGAAGG - Intergenic
1133659412 16:7902079-7902101 ACTCAGCAACACAAACAAAATGG + Intergenic
1138036439 16:53611695-53611717 AAGTCTCAACAGAAAGAAGACGG + Intronic
1138403107 16:56765076-56765098 TATTAAGAACAGAAACAAGATGG - Intronic
1138794938 16:59956446-59956468 CTTTCTCAACAGAATCAAGAGGG - Intergenic
1138808191 16:60118206-60118228 GCTTATTATCAGAGACAAGAAGG - Intergenic
1139260080 16:65583384-65583406 ATTTGTCAACTGAAACAAAATGG - Intergenic
1141862325 16:86726329-86726351 ACTTATGAAAAGAAACGAGGCGG + Intergenic
1145202618 17:20960155-20960177 TCTTATAAACAGGAAAAAGATGG - Intergenic
1145220513 17:21084771-21084793 ACTTCTCATCAGAAACGAGGGGG - Intergenic
1146900758 17:36586010-36586032 ACTTAAGAACATAAATAAGAAGG + Intronic
1150686660 17:67326507-67326529 CTTAATCATCAGAAACAAGATGG - Intergenic
1152995608 18:403623-403645 AATTCTCAAAAGAAATAAGAAGG - Intronic
1153086211 18:1291085-1291107 ACTTTTCAACAGAAAAAAAGGGG - Intergenic
1153182280 18:2447970-2447992 CCCTATCATCAGAGACAAGATGG + Intergenic
1153664899 18:7359997-7360019 AGTTATGAACAGAAAGGAGAGGG - Intergenic
1153888354 18:9488363-9488385 ACATATGCAAAGAAACAAGAAGG - Intronic
1153960083 18:10132999-10133021 ACTTTGCAACAGATACAAGAGGG - Intergenic
1155027228 18:21952421-21952443 AAATATCAAAAGAAACCAGAGGG - Intergenic
1157044955 18:44091116-44091138 AATTATCAACAGTAGCAAAAAGG - Intergenic
1157178251 18:45471687-45471709 ACCCATCAGCAGCAACAAGACGG - Intronic
1157506903 18:48232944-48232966 GCAAAACAACAGAAACAAGAAGG + Intronic
1157678225 18:49583390-49583412 TCCTATCAACAGGACCAAGATGG - Intronic
1158003280 18:52643848-52643870 ACTTGTCAGGACAAACAAGATGG - Intronic
1160220039 18:76968718-76968740 TCTTATAACCAGAAACATGAAGG - Exonic
1160370314 18:78367223-78367245 AGTTCTCATCAGAAACAACATGG - Intergenic
1160891827 19:1383098-1383120 ACTTATCAATTTAAGCAAGATGG + Intergenic
1161041387 19:2112461-2112483 ACTGATCCACAGAGACAGGAAGG + Intronic
1161534113 19:4808336-4808358 GCTCATCCACAGAAACAGGAAGG + Intergenic
1163077438 19:14907165-14907187 ACTTATTATGAGAAACAGGATGG + Intergenic
1163729053 19:18939458-18939480 AATTATAAAAAGAAACAAAAAGG + Exonic
1164645056 19:29852901-29852923 ACTTATGAACACAAAGAAGAAGG - Intergenic
1165650971 19:37489714-37489736 AAATATCAACAGAAACAGGATGG + Intergenic
1167777627 19:51571285-51571307 ACTTAACAACAGAAGCTAAATGG - Exonic
1168302055 19:55410738-55410760 ACTTATGAACAGAAACAGGGAGG + Intergenic
926074425 2:9929720-9929742 TCCAATCAACAGAAAAAAGAGGG - Intronic
926660557 2:15461151-15461173 AATTATCAATATAAAAAAGAAGG + Intronic
927301148 2:21516818-21516840 ACTTTTCAACAGCAAAAATATGG - Intergenic
928656432 2:33456565-33456587 AATTTTCAACAGGAATAAGATGG - Intronic
931860499 2:66349418-66349440 TCTAATCAACAGAAAAAAGAGGG - Intergenic
932827441 2:74954877-74954899 ACTTACCACCAAAACCAAGATGG + Intergenic
934733208 2:96672522-96672544 GGTTGGCAACAGAAACAAGAGGG + Intergenic
935605333 2:104967048-104967070 ACTTAACATCACAAAAAAGAGGG - Intergenic
936772441 2:115930787-115930809 ACTTATTAGCAGAATCAACATGG - Intergenic
936983054 2:118281865-118281887 ATATATGAACACAAACAAGATGG - Intergenic
937361447 2:121232689-121232711 ACTTGACAACAGAAAGGAGAAGG + Intronic
937407767 2:121646713-121646735 ACTTAAGAAAATAAACAAGACGG + Intronic
937512977 2:122619098-122619120 ACTTATCAATAGCACCAAAAGGG - Intergenic
937819372 2:126290654-126290676 AAATATCAATAGAAATAAGAGGG + Intergenic
937939126 2:127271448-127271470 ACCTACCTACAGAAACAAGTTGG + Exonic
938838404 2:135132343-135132365 ACATATAAACAGAAACCACATGG + Intronic
939112697 2:138027563-138027585 AGTTAATAACAGAAACAAGGAGG - Intergenic
939701521 2:145398495-145398517 AATTACCAATAGAAACAAAAAGG + Intergenic
940981942 2:160013229-160013251 TTTTTTTAACAGAAACAAGACGG - Intronic
941191261 2:162385701-162385723 AGTTATTAGCAGAAACCAGATGG - Intronic
941279239 2:163529990-163530012 ACTTTTCTTCAAAAACAAGAAGG - Intergenic
941733195 2:168942769-168942791 AATTATCAACTAAAACAATAAGG + Intronic
941835538 2:170014045-170014067 CCTTATCAGCAGCAACCAGATGG + Intronic
943373749 2:187049601-187049623 AATTATCAATAGAAAAAACAGGG - Intergenic
944963582 2:204903505-204903527 AGTTATCAATATAAACAACATGG - Intronic
947693295 2:232160523-232160545 ACTGATCAAGAAAAACAAGGAGG - Intronic
948552223 2:238780955-238780977 ATTTCTCATCAGAAACAATACGG - Intergenic
1169838852 20:9911667-9911689 ACTTACAAACAGAAGCACGAGGG - Intergenic
1170107842 20:12771296-12771318 ACTTACCAACATAATAAAGATGG + Intergenic
1171157353 20:22888486-22888508 TCTGATCCACAGAAACAGGATGG + Intergenic
1171725448 20:28616123-28616145 ACTTCTCAGCAGAAACAATATGG - Intergenic
1171752618 20:29066961-29066983 ACTTCTCAGCAGAAACAATATGG + Intergenic
1171789651 20:29510613-29510635 ACTTCACAGCAGAAACAATATGG - Intergenic
1173039699 20:39450833-39450855 AGACATCAACACAAACAAGATGG - Intergenic
1173420638 20:42898206-42898228 TCTTAACAACAGCAACAAAAAGG - Intronic
1174254261 20:49242637-49242659 ACTCACCAACACAAGCAAGAAGG + Exonic
1178162257 21:29932160-29932182 ACTAATCAAAAGACACAACATGG + Intronic
1179349625 21:40595646-40595668 ACTTATCAACAGAAAAGATGAGG + Intronic
1180389801 22:12218316-12218338 ACTTATCATGAGACACACGAAGG + Intergenic
1180390339 22:12275727-12275749 ACTTCTCAACAGAAACAATATGG - Intergenic
1180409402 22:12589028-12589050 ACTTCTCAGCAGAAACAATATGG + Intergenic
1180452598 22:15480269-15480291 ACTTCTCATCAGAAACAATGTGG - Intergenic
1183325572 22:37190027-37190049 GCTTCTCGTCAGAAACAAGAGGG - Intronic
1184481371 22:44749766-44749788 ACTAATATACAGAAACAATAAGG + Intronic
949974377 3:9442080-9442102 AATTCTCAACACAAATAAGAAGG - Intronic
950489851 3:13297534-13297556 ACTTATCAACACATAGAAGCTGG - Intergenic
952627943 3:35429264-35429286 ACTTATCCACAGTAACAGCAGGG - Intergenic
954185287 3:48912347-48912369 ACATCTCAAAAGAAAAAAGAGGG + Intergenic
955762050 3:62296734-62296756 ACTTATCTCTAGAAAGAAGAAGG + Exonic
957437059 3:80191582-80191604 ACATATCAACATAAAAGAGAAGG - Intergenic
958497201 3:94860588-94860610 ACATCTTAACAGAAAAAAGAGGG - Intergenic
958510811 3:95046006-95046028 AGTAATCTGCAGAAACAAGAAGG + Intergenic
958717053 3:97796766-97796788 ATTTATCAACAGCAACAACTTGG + Intronic
959053702 3:101548956-101548978 ACTTATCACCAGAGATGAGATGG - Intergenic
960033242 3:113076911-113076933 CTTTATCACCAGAAACAAGGTGG + Intergenic
960269769 3:115660904-115660926 ACCTGGCAACAGAAACAAAAAGG - Intronic
960797267 3:121500865-121500887 ACTTCTCACCAGCAACAAGAAGG + Intronic
960858210 3:122124292-122124314 ACACACCAAGAGAAACAAGAAGG + Intergenic
961602239 3:128071203-128071225 ACTCAGCAGCAGAACCAAGATGG + Exonic
963265202 3:143233279-143233301 ATTTATCAAGATAAAGAAGAAGG - Intergenic
963738417 3:149048873-149048895 ACTTAGAATCAGAAAGAAGATGG - Exonic
964181562 3:153893856-153893878 ATTAATCTACATAAACAAGATGG + Intergenic
964825377 3:160821078-160821100 ACTTCTCAACAGGAACAAAGCGG + Intronic
964944325 3:162201197-162201219 ACACATCAGCTGAAACAAGAAGG + Intergenic
965085170 3:164086408-164086430 GCTTATCAACAGAAATATGGGGG + Intergenic
966985868 3:185179825-185179847 GTTTATTTACAGAAACAAGAGGG + Intergenic
967234441 3:187370636-187370658 ATTGATAAACAGGAACAAGAAGG - Intronic
968335486 3:197909473-197909495 ACTTAGAGACAGAACCAAGAAGG + Intronic
970339827 4:15094168-15094190 ACATATTAACAGAAAAAAGGGGG - Intergenic
970363849 4:15337987-15338009 ATTTATAAACAGAAATAAGAGGG - Intergenic
970711839 4:18872815-18872837 ACTGCTCAGAAGAAACAAGAGGG - Intergenic
970926534 4:21458884-21458906 CCATATTAAGAGAAACAAGAGGG - Intronic
971423156 4:26492099-26492121 ATTTAGTCACAGAAACAAGAAGG + Intergenic
972030376 4:34449657-34449679 TCTGATCAACAGAAAAATGATGG + Intergenic
972199520 4:36697285-36697307 ATTTATGAAAAGAAACAAGTTGG + Intergenic
973812325 4:54583673-54583695 CCTTATGAACAGATACAAGCAGG - Intergenic
974083514 4:57236157-57236179 ACTCATGGACTGAAACAAGATGG - Intergenic
974450612 4:62051985-62052007 ATTTATCAACAAATACAAGGAGG - Intronic
974845122 4:67342657-67342679 ACTGATTAACAGAAAAAAAAAGG + Intergenic
975261984 4:72313767-72313789 GCTAATCAGCAAAAACAAGATGG - Exonic
975545412 4:75555684-75555706 ACTTAAAAAGCGAAACAAGAGGG - Intergenic
975831926 4:78378257-78378279 ACTCATCTACAGAAAGAAAAAGG - Intronic
976319520 4:83697354-83697376 ACTTCTCAATAGAAACAATGAGG - Intergenic
976824609 4:89247132-89247154 ATTTATTAACAGCAATAAGAAGG + Exonic
977251070 4:94689489-94689511 ACATATCAACAAAAACAAGGTGG - Intergenic
977623744 4:99166750-99166772 GCTGCTCAAAAGAAACAAGAGGG - Intergenic
977792296 4:101121827-101121849 ACATATGAACAGAAAACAGATGG + Intronic
977940642 4:102854775-102854797 GAGTAACAACAGAAACAAGAAGG + Intronic
978119427 4:105060647-105060669 ACTTATTAACAGGAACCAGGAGG - Intergenic
978524444 4:109651279-109651301 ACTTATCAAAAGAACCCAGAAGG - Intronic
978557348 4:109995067-109995089 ACTTATCACCGGTAACTAGAAGG - Intronic
978691677 4:111520195-111520217 CCTTAAAAACAGAAACAAAAAGG - Intergenic
979069816 4:116187626-116187648 AGTTGTCAACATAAAAAAGAAGG - Intergenic
979103024 4:116646783-116646805 ACTTATCAAAACAAACAATTTGG + Intergenic
979390708 4:120124021-120124043 ACTTGTCAACAAAAACAAGTAGG - Intergenic
979830594 4:125296264-125296286 ACATATCAACAGGATAAAGAAGG - Intergenic
979873344 4:125854379-125854401 AAATAACAACAAAAACAAGAAGG - Intergenic
980171054 4:129290831-129290853 AAAGATCAAAAGAAACAAGAAGG - Intergenic
980626589 4:135381292-135381314 GATTATTAACAGAAGCAAGATGG - Intergenic
981186005 4:141804207-141804229 ACTTATGAAAAGAGAAAAGAAGG + Intergenic
981499704 4:145436874-145436896 ACTTATGGGCAGAGACAAGAGGG + Intergenic
981730976 4:147898347-147898369 ACTTATCATCAGAAAATAAACGG - Intronic
982030064 4:151291893-151291915 ACTCCTCAACTGTAACAAGAGGG + Intronic
982582037 4:157191217-157191239 ACATTTCATCTGAAACAAGAAGG - Intergenic
982773482 4:159419565-159419587 ACTTAAGGACAGAAAAAAGAAGG - Intergenic
982910713 4:161138663-161138685 ACTTCTCAACAGAAACCGAATGG + Intergenic
983384811 4:167046908-167046930 ACTCAGAAACAGAAACAAAATGG + Intronic
983587689 4:169373594-169373616 ACTTTTCAACAGATAAAATAAGG + Intergenic
984807218 4:183762935-183762957 TTATATCAACAGAAACCAGAAGG - Intergenic
985515058 5:338470-338492 ATTCCTCATCAGAAACAAGAAGG - Intronic
986236626 5:5916443-5916465 ACTTAATAACACAAATAAGATGG - Intergenic
986335798 5:6754475-6754497 ACTTATCCATAGAAATAAGAAGG - Intronic
989031564 5:37124515-37124537 ACTTATGAACAGAAAATTGAAGG + Intronic
990839219 5:60056985-60057007 ACCTATCAACAGAAACTTAAAGG + Intronic
992158950 5:73981974-73981996 TCTCATCAGCAGAAACAAGAAGG - Intergenic
992399596 5:76400283-76400305 ACTTGTCAAAAGAAAACAGATGG + Intergenic
992558190 5:77923996-77924018 TCCCATAAACAGAAACAAGAAGG + Intergenic
993043774 5:82844415-82844437 GCTTATCAACACAATCAAGGTGG - Intergenic
993108410 5:83626285-83626307 ACTTATCAACAAAGACATCATGG + Intergenic
995507701 5:112877521-112877543 GCTTATCAACACAAAGAATACGG + Exonic
995886149 5:116896111-116896133 AGAAAGCAACAGAAACAAGAAGG - Intergenic
996561259 5:124831992-124832014 ATTTATAAACAGAAATGAGAAGG - Intergenic
996596913 5:125214459-125214481 ACTCATCAAAGGAAACGAGATGG - Intergenic
997166630 5:131667196-131667218 ACTTAGCAACAGAGAAAATAAGG - Intronic
999035189 5:148341236-148341258 ACTTATAAGCAGAAACCTGAAGG + Intergenic
999543720 5:152603500-152603522 ACATGTCAACAACAACAAGAAGG - Intergenic
1000432780 5:161169707-161169729 ACTTATCAACTAAAAATAGAAGG - Intergenic
1000995156 5:167951054-167951076 CCTGACCAACAAAAACAAGAAGG - Intronic
1002769225 6:276152-276174 CCTTATGATCAGGAACAAGAAGG - Intergenic
1002853968 6:1021359-1021381 ACTGAACGAAAGAAACAAGAGGG - Intergenic
1004488913 6:16095219-16095241 CCTTAAAAACAAAAACAAGAAGG + Intergenic
1004676691 6:17849521-17849543 ACTTATCAATAAAAACCACATGG + Intronic
1005531824 6:26715190-26715212 ACTTCTCATCAGAAACCATAGGG + Intergenic
1005538971 6:26786475-26786497 ACTTCTCATCAGAAACCATAGGG - Intergenic
1006759944 6:36451409-36451431 ATGTATCCACAGAAAAAAGATGG - Intronic
1007520010 6:42444688-42444710 ACTGATCAAGAGAAACGAGTTGG - Intronic
1007636012 6:43300228-43300250 AGAGATCAACAGAAAGAAGATGG + Intronic
1007996046 6:46309065-46309087 ACTAATCAATAGAAAAGAGATGG + Intronic
1008321740 6:50122354-50122376 ACTTAGCAAAGGAGACAAGAGGG - Intergenic
1009009810 6:57828702-57828724 ACTTCTCATCAGAAACCATAGGG - Intergenic
1009568681 6:65351029-65351051 AATTATCAAAAGAAATAAGAAGG + Intronic
1011063961 6:83303843-83303865 TATTAACAACAGAAACAATAAGG + Intronic
1011516734 6:88163635-88163657 ACTTATCAACACAATCAATGGGG + Intronic
1016094986 6:140024851-140024873 ACATATCAAAAGTAACAAGATGG - Intergenic
1017116785 6:150985225-150985247 ATTTACCAAAAGAAAAAAGATGG - Intronic
1017277518 6:152587250-152587272 ACTTATCAAAAGCAACAAAAAGG - Intronic
1017848938 6:158285820-158285842 GCTTACCATCAGAACCAAGAAGG + Intronic
1019115748 6:169760585-169760607 ACTGATCAACTGAAAAAAGATGG - Intronic
1019935442 7:4252831-4252853 ACTTAACAAAAAAAAAAAGAGGG - Intronic
1021584290 7:22191243-22191265 TCTTATTAACAGAAACCACATGG + Intronic
1021970495 7:25960993-25961015 GCTAATGAAGAGAAACAAGAGGG - Intergenic
1023585380 7:41724487-41724509 ACTTTTCATCAGAAAGAAGACGG - Intergenic
1023683994 7:42716801-42716823 GATATTCAACAGAAACAAGAAGG - Intergenic
1024721401 7:52140879-52140901 ATTTTACAACAGAAAGAAGATGG - Intergenic
1024770249 7:52713757-52713779 ACTCAACAACAGATACAATAAGG + Intergenic
1025115511 7:56254763-56254785 ACTTATGAACAGAAGGAGGACGG - Intergenic
1026199895 7:68205638-68205660 ACTTATGAACAGAATGAGGACGG - Intergenic
1026771673 7:73205362-73205384 TTCTATCAACAGAAACAAAACGG - Intergenic
1027012541 7:74758759-74758781 TTCTATCAACAGAAACAAAACGG - Intronic
1027075499 7:75187294-75187316 TTCTATCAACAGAAACAAAACGG + Intergenic
1027552131 7:79612282-79612304 ACTGATCCACAGATGCAAGAGGG + Intergenic
1027865955 7:83647312-83647334 ATTTATCAGGAGAAACAAAAAGG - Intronic
1028675889 7:93460090-93460112 ACTTGGCAACAGAATGAAGAGGG + Intronic
1029035398 7:97514712-97514734 ACTTATCAATAGTAGAAAGATGG - Intergenic
1029266457 7:99345427-99345449 CCTTATCAAAACAAACAGGAAGG - Intronic
1029824970 7:103181629-103181651 ACTTGTCAACTGAAACTAAAAGG - Intergenic
1031316781 7:120268314-120268336 ACTGATCAAAAGAGAAAAGAGGG + Intergenic
1031562149 7:123251346-123251368 AGTTAACAAAAGAAACAAAAAGG - Intergenic
1031782304 7:125984211-125984233 TCATATGAACAGAAACAAAAAGG - Intergenic
1031987585 7:128173125-128173147 ACTTCTCAGCAGTAACCAGAGGG + Intergenic
1032228659 7:130054851-130054873 ACTGATCAATAGTAACAGGAGGG - Intergenic
1032306824 7:130741871-130741893 TCTTATAAGCAGAAATAAGAAGG - Intergenic
1036025877 8:4908370-4908392 ACTAAACTACAGAACCAAGAAGG - Intronic
1036501856 8:9321438-9321460 ACTTGTCAACAAAAGTAAGATGG - Intergenic
1037189448 8:16104807-16104829 TCTCATCAACAGAAACCATAAGG - Intergenic
1037549433 8:19956207-19956229 CCCTATCAACAGAAACACCAGGG - Intronic
1039698179 8:39934844-39934866 ACTTTGCCACAGAAAGAAGATGG + Intronic
1040452323 8:47560486-47560508 ACTTATAAGCAGAAACTGGAAGG - Intronic
1040524917 8:48213235-48213257 ACTGATTTACAGAAATAAGAAGG + Intergenic
1041053364 8:53958296-53958318 AGTGATCAACAGAAACATGGTGG + Exonic
1042882022 8:73503978-73504000 ACATATAAAAAGAAAGAAGAGGG + Intronic
1043020964 8:74999174-74999196 ACTTGTTAACAGAATCAATAAGG + Intronic
1043425107 8:80140796-80140818 ACTTAGCAACAGGAAAACGATGG + Intronic
1045045956 8:98278118-98278140 ACTTATCAACAACAACAATAAGG - Intronic
1045710628 8:104979346-104979368 CCTTATAAAAAGAAACTAGAGGG - Intronic
1046796222 8:118375692-118375714 ATTTTTAAAAAGAAACAAGAAGG - Intronic
1047115401 8:121836479-121836501 ACTCTTCAATAAAAACAAGAGGG + Intergenic
1047965566 8:130043913-130043935 ACGAATCTACAGAAACAGGAAGG + Intergenic
1048114242 8:131503664-131503686 ATTAATCAACAGATCCAAGAAGG + Intergenic
1048801229 8:138195798-138195820 TCTTATCAGCAGAAACCAGGTGG + Intronic
1048945406 8:139442475-139442497 CCTTATTAACTGGAACAAGAGGG + Intergenic
1049153118 8:141048741-141048763 ACTTATAAAAAGAACCAAGTAGG + Intergenic
1050519726 9:6484712-6484734 ATTTATTAATAGAAATAAGAAGG - Intronic
1050776633 9:9270957-9270979 ACTTATTAATATAAAGAAGACGG + Intronic
1051872916 9:21759387-21759409 ATGTATCCAAAGAAACAAGAAGG - Intergenic
1051912460 9:22169989-22170011 ATACATCAACAGAAAGAAGAAGG - Intergenic
1052507039 9:29369144-29369166 ACTTATCAAAAGAAGAAATAAGG + Intergenic
1052871193 9:33508725-33508747 ACTTATCAACAGAAACAAGTTGG + Intergenic
1055588414 9:77782856-77782878 ACTTATCAGGAGAAGCTAGATGG + Intronic
1056339446 9:85611039-85611061 ACTTATCATCAGAATCTGGAAGG + Intronic
1058778926 9:108313727-108313749 TCTTCCCAACATAAACAAGAAGG - Intergenic
1059078246 9:111218206-111218228 AATGATCAACTCAAACAAGAAGG - Intergenic
1059998920 9:119940697-119940719 ACAAATGAACAGAAAAAAGATGG + Intergenic
1060101368 9:120843460-120843482 ACTGATCAACACCAACAAGGCGG - Intergenic
1061641015 9:131955516-131955538 ACTGATCAAGAGCAAAAAGAGGG + Intronic
1203450972 Un_GL000219v1:116021-116043 ACTTCTCAGCAGAAACAATATGG - Intergenic
1185469159 X:372324-372346 AAATATCAACAGAAAGAAGTGGG + Intronic
1186561868 X:10621284-10621306 ACTTATTAACAGGGACAAGCTGG + Intronic
1188133791 X:26469696-26469718 ACTACTCAGAAGAAACAAGAGGG - Intergenic
1190469393 X:50762732-50762754 ACTTCTCATCAGAAAGAAAATGG - Intronic
1190689402 X:52900995-52901017 ATCTATCAAATGAAACAAGAAGG - Intronic
1190696581 X:52954797-52954819 ATCTATCAAATGAAACAAGAAGG + Intronic
1191908646 X:66123563-66123585 GCTTATCAACACAATCAAGTCGG - Intergenic
1192025506 X:67446260-67446282 TCCTATCAAGAGAAACATGATGG - Intergenic
1192542301 X:71984517-71984539 GCTTCTCAGAAGAAACAAGAGGG - Intergenic
1193454587 X:81714734-81714756 ACTTATCAAAACAAACACAAGGG - Intergenic
1193987035 X:88255479-88255501 ACTTTTCTTCAGAAACTAGAAGG - Intergenic
1194548370 X:95267126-95267148 AATTATTAACAGAAAAAAAACGG - Intergenic
1195445140 X:104943627-104943649 ACTTATGAACAAAGACTAGAAGG - Intronic
1195614020 X:106898637-106898659 ACTTACAAACAGAAACAGAATGG + Intronic
1196906932 X:120446614-120446636 ACTTAAAAAAAAAAACAAGAGGG + Intronic
1198847075 X:140923807-140923829 GCTGATCAGAAGAAACAAGAGGG - Intergenic
1198913978 X:141646262-141646284 ACTTATTGGCAGAAATAAGAGGG - Intronic
1199316302 X:146382088-146382110 ACCTATAAAAAGTAACAAGAAGG + Intergenic
1199429610 X:147744173-147744195 TCTTATGAACAGAACCAACAGGG - Intergenic
1200808459 Y:7457617-7457639 ACTCATCTACAGAAACATCATGG + Intergenic
1202342181 Y:23881552-23881574 ACTGATCAACATCAACAAAAAGG - Intergenic
1202528588 Y:25788533-25788555 ACTGATCAACATCAACAAAAAGG + Intergenic