ID: 1108671298

View in Genome Browser
Species Human (GRCh38)
Location 13:52691853-52691875
Sequence AAAAATGCACAGATGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 703
Summary {0: 1, 1: 0, 2: 2, 3: 64, 4: 636}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108671298_1108671300 22 Left 1108671298 13:52691853-52691875 CCTTTCTCCATCTGTGCATTTTT 0: 1
1: 0
2: 2
3: 64
4: 636
Right 1108671300 13:52691898-52691920 CACACCAAGAGATTTTATTTTGG 0: 1
1: 0
2: 0
3: 15
4: 221
1108671298_1108671301 23 Left 1108671298 13:52691853-52691875 CCTTTCTCCATCTGTGCATTTTT 0: 1
1: 0
2: 2
3: 64
4: 636
Right 1108671301 13:52691899-52691921 ACACCAAGAGATTTTATTTTGGG 0: 1
1: 0
2: 3
3: 32
4: 380

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108671298 Original CRISPR AAAAATGCACAGATGGAGAA AGG (reversed) Intronic
900389039 1:2426171-2426193 ACATCTGCACAGATGGTGAAAGG - Intronic
900953230 1:5871112-5871134 AAAAATGCACAAACAGAGAGTGG + Intronic
901471932 1:9463130-9463152 AAAAATGGACAGATTGGGCATGG - Intergenic
902350537 1:15850175-15850197 CAGAATGCACAGAGGGAGGAGGG + Intronic
902373969 1:16021626-16021648 GAAAAAGCACAGAGGGAGAGGGG - Intronic
902457304 1:16544217-16544239 AAAAATTAGCAGATGGGGAATGG + Intergenic
902483916 1:16729050-16729072 AAAAATTAGCAGATGGGGAATGG - Intergenic
902494863 1:16863695-16863717 AAAAATTAGCAGATGGGGAATGG - Intronic
902720248 1:18299473-18299495 GAAAATATACAGAGGGAGAAGGG - Intronic
904099810 1:28015422-28015444 AAACATGAAAAGAAGGAGAATGG + Intronic
904919048 1:33992365-33992387 AAAAATACAAAGAAGTAGAAGGG - Intronic
904957559 1:34297717-34297739 AAAAATGAAGAGATGAACAAGGG - Intergenic
905094664 1:35459211-35459233 AAACTTGAACAGATTGAGAAGGG + Intronic
905108846 1:35579819-35579841 AAAAATGTGCAGATGGAGTTTGG + Intronic
905660289 1:39717309-39717331 AAAAAAGCACAGATGGAATTGGG - Intronic
906013982 1:42556582-42556604 TAAAAACCACATATGGAGAATGG + Intronic
906446039 1:45898925-45898947 AAGAATGCCCATATGGAGCATGG - Intronic
907205727 1:52768903-52768925 AAGAATTCAAAGATAGAGAAAGG - Intronic
907664346 1:56421248-56421270 ATAAATGCAAAGATGGTGGATGG - Intergenic
907764135 1:57391717-57391739 AAGAATGCACAGATGGATTAGGG - Intronic
908558764 1:65284298-65284320 AGAAAGGCAGAGATGGAGAAAGG - Intronic
910434543 1:87191833-87191855 AAAAATGCACAGATTGTGGAGGG - Intergenic
910621088 1:89255548-89255570 CATAATGATCAGATGGAGAAGGG - Intergenic
910645769 1:89513567-89513589 AAAAATGGACAAATGGACAAAGG - Intergenic
911132931 1:94408993-94409015 AAAAAGGAACAGATTGATAAGGG - Intergenic
911511982 1:98818099-98818121 GAAAGGGCACAGATGGACAAGGG - Intergenic
911753502 1:101525943-101525965 CAAAATGCAGAGATGGAAAAGGG - Intergenic
911898572 1:103471353-103471375 AAAAAGGAAGAGAGGGAGAAAGG - Intergenic
912544985 1:110444246-110444268 AAAAAGGCACAGAAGGGCAAGGG + Intergenic
912592883 1:110844648-110844670 AAAAGTTAACAGATGGAGAAAGG - Intergenic
913092368 1:115486122-115486144 AAAAATAAAGGGATGGAGAATGG + Intergenic
913348718 1:117833874-117833896 AAAAATACACAGCTGGAAAGTGG + Intergenic
914227459 1:145732845-145732867 AAGAATGCAGAGAAGGAAAATGG + Intronic
914720512 1:150285073-150285095 AGAAATGAAAAGAAGGAGAAGGG - Intronic
914822741 1:151117573-151117595 AAAAAAGAAAAGATGAAGAAGGG - Intronic
914902328 1:151717303-151717325 AAAAATGCAGAGAGGAAAAATGG + Intronic
915909880 1:159908362-159908384 AAAGATGCACAAATAGAAAAGGG - Intergenic
917476408 1:175373065-175373087 AAACATGCACAGAAGCAGCATGG + Intronic
917670623 1:177270270-177270292 AAAAACCCACAGAGTGAGAAAGG - Intronic
917677341 1:177332457-177332479 AAAAATCCACAGCTGAATAATGG - Intergenic
917771536 1:178285009-178285031 AAAAATGCTGAGAAAGAGAAGGG - Intronic
918070567 1:181131008-181131030 ATAAATGAATAAATGGAGAATGG - Intergenic
918941431 1:191003661-191003683 AAAAATAATCACATGGAGAATGG + Intergenic
919140745 1:193568320-193568342 AAAAATGAAATGATGGAAAATGG - Intergenic
919160918 1:193830091-193830113 AAAAGAGCGCAGATGGAAAAAGG - Intergenic
919304339 1:195810845-195810867 AGAAAAGCACAGATGGAAATAGG + Intergenic
920910732 1:210213897-210213919 AAAAAGACAGAGATGGAAAATGG + Intergenic
921620630 1:217322476-217322498 GAAAATGAAAAGATGGAAAATGG + Intergenic
921636781 1:217504959-217504981 AAAAATGCTCTGAAAGAGAATGG + Intronic
921860461 1:220037521-220037543 AAAAATAGAAAGATGGAAAATGG + Intronic
922349436 1:224723328-224723350 GAAAAGGCACAGAGAGAGAAGGG - Intronic
923082494 1:230671885-230671907 AAAAGTGCAGAGAAGAAGAAAGG - Intronic
924054150 1:240108738-240108760 AAAAATGCACAGAAGGGGCCTGG + Intronic
924133530 1:240938187-240938209 AAAAATCCACAGATGTGGGAGGG - Intronic
924319428 1:242832932-242832954 AAAAATTCACAAATGGAAAGAGG + Intergenic
1062895286 10:1098309-1098331 AAAAACGGACAGATGGGGAGGGG - Intronic
1062941472 10:1424676-1424698 TAAAAGGCACAGATGGGGCATGG + Intronic
1063918490 10:10908543-10908565 ATAAATACACTGTTGGAGAAAGG + Intergenic
1064206009 10:13324125-13324147 AAAACTGTAGAGATGCAGAAAGG - Intronic
1064207345 10:13335373-13335395 AAAAATGCACAGGTCGGGCACGG + Intronic
1064754353 10:18560961-18560983 TGAAATGCAGTGATGGAGAATGG + Intronic
1064755264 10:18567392-18567414 TGAAATGCAATGATGGAGAATGG - Intronic
1065278383 10:24109526-24109548 AAAAATGAACAGATGGAAACTGG + Intronic
1067310977 10:45113331-45113353 AAAATAGAACAGATGGAGACAGG - Intergenic
1068076257 10:52258918-52258940 TTAAATGAACAGATGGGGAAAGG + Intronic
1068583972 10:58775666-58775688 AATAATGCACAGTTGGGGAGAGG + Intronic
1068638658 10:59376601-59376623 AGAAATGCACATATGGAGCCTGG + Intergenic
1069091669 10:64206808-64206830 AAACATGAACAGAGTGAGAAAGG - Intergenic
1069117149 10:64521768-64521790 AAATATGTCTAGATGGAGAAAGG - Intergenic
1069586423 10:69606937-69606959 AAAACTCAACAAATGGAGAAGGG + Intergenic
1069875289 10:71559252-71559274 AAAAATGCACAAATCCACAAGGG - Intronic
1070053328 10:72910353-72910375 AAAAATACACAGATGTATAATGG + Intronic
1070557410 10:77539303-77539325 GATAATGCAGAGATGGAGATGGG + Intronic
1070623978 10:78035859-78035881 TAAAATGCACAGGTGGAGTACGG + Intronic
1072622194 10:97087411-97087433 ACAAATGCAGGGATGGAGACGGG - Intronic
1072722048 10:97787160-97787182 AGAGATGGACAGATGGACAAAGG - Intergenic
1072927213 10:99626509-99626531 ATAAAAGGACAGATTGAGAAAGG - Intergenic
1072985696 10:100138069-100138091 AATAATGCAGAGAAGGGGAACGG - Intergenic
1073812746 10:107168420-107168442 AAAAATCCACATGTGGATAAAGG + Intergenic
1073851526 10:107624586-107624608 AAGAATGCACAGAGAGGGAAAGG - Intergenic
1074594831 10:114852574-114852596 CAAAAAGCAAAAATGGAGAAGGG - Intronic
1074659001 10:115629309-115629331 ATAAATGCTCAGATTGAGTACGG + Intronic
1074718188 10:116240003-116240025 AGCAATTCACAGAGGGAGAAAGG + Intronic
1075081300 10:119385684-119385706 ACAAATGGAAAGATGGAGTAAGG + Intronic
1075474272 10:122719801-122719823 AAAAAGGCATAGAAGGAGAGAGG - Intergenic
1076243774 10:128930375-128930397 AAAAATGCACAGTGGCAGATTGG - Intergenic
1077280616 11:1743486-1743508 ATGGATGGACAGATGGAGAATGG + Intronic
1077425681 11:2474969-2474991 AACAATGCACAAATGCACAAAGG - Intronic
1077665089 11:4101075-4101097 GAAAAAGCACAGAAGGGGAAGGG + Intronic
1078048652 11:7942019-7942041 AAATAGGCACAAATGCAGAAGGG + Intergenic
1078734112 11:14003961-14003983 AAATATGCAGAGATAGATAAGGG - Intronic
1078954659 11:16177964-16177986 AGATAAGCACAGATAGAGAAGGG + Intronic
1080998612 11:37638513-37638535 AAAAAATCAAAGATGGACAAAGG - Intergenic
1081371987 11:42315567-42315589 AAAACTGCAAAGATAGAAAATGG + Intergenic
1081591437 11:44425943-44425965 AAAAAGGCAGAGAATGAGAATGG + Intergenic
1083059336 11:59853147-59853169 AAAAATGCCCAAATGGAGAGGGG - Intronic
1084352379 11:68611553-68611575 AAAGAAGGACAGATGGATAAAGG - Intronic
1084680845 11:70665433-70665455 GAAAATTCTCAGATGGAGCAGGG - Intronic
1084775934 11:71375527-71375549 AAATTTGCCCAGAAGGAGAAAGG + Intergenic
1085550787 11:77369248-77369270 AAAAATTCCCAGCTGAAGAAAGG - Intronic
1085976499 11:81661465-81661487 CACAATGCACAGATGGGGCATGG - Intergenic
1086478707 11:87209335-87209357 CAAAATAAAGAGATGGAGAAAGG + Intronic
1086820182 11:91426105-91426127 AGGAATGCACAGGTGGAGAGAGG - Intergenic
1086952284 11:92903576-92903598 ATAAACACACAGATGGAGATGGG + Intergenic
1087303245 11:96459730-96459752 AAAAATCCATTGAAGGAGAATGG + Intronic
1087717360 11:101623882-101623904 ATAAAAGCACTGAAGGAGAAAGG - Intronic
1087788574 11:102383468-102383490 AAATATGCAAAGTTGGAGAATGG + Intergenic
1088306502 11:108415182-108415204 AAAAGTATACAGATTGAGAAGGG + Intronic
1088782800 11:113152309-113152331 AGAAATGCACAGATGCAGTATGG - Intronic
1089908787 11:122074453-122074475 AAACTTGGACAGATGGAGATGGG - Intergenic
1090115102 11:123962357-123962379 AAAAATGCAATGATGGAGTAAGG + Intergenic
1090161843 11:124503495-124503517 AAAATTGCAGGAATGGAGAATGG - Intergenic
1090307118 11:125701045-125701067 AAAAAACCACAGATGGATCATGG + Intergenic
1090638595 11:128710241-128710263 AAAAATGAAGAGATGAAGAAAGG + Intronic
1090960060 11:131548271-131548293 AAAAATGCACAAGGGGAGAGTGG - Intronic
1091024510 11:132130113-132130135 AAATATTCTCAGAAGGAGAAGGG + Intronic
1091147908 11:133296576-133296598 ACAAAAGCACAGAGGGACAATGG - Intronic
1091150340 11:133322769-133322791 AAAACTGGACATATTGAGAAGGG - Intronic
1091855779 12:3738109-3738131 AAAACTGATCAGATGGAGATTGG - Intronic
1092047344 12:5441295-5441317 ACAAATGCGTGGATGGAGAAGGG + Intronic
1092206400 12:6616822-6616844 GAAAATCCAAAGATAGAGAAGGG - Intergenic
1092837113 12:12501040-12501062 AATAATTCACAGAAGCAGAATGG + Intronic
1093205567 12:16244610-16244632 AAAAATGAAGAGAGGGAGAAGGG + Exonic
1094293132 12:28874394-28874416 AAAAAAGCAAAGATTGAGAGAGG + Intergenic
1096757359 12:53811139-53811161 AAAGATACAAAGATGGACAAAGG + Intergenic
1097378600 12:58867233-58867255 AAAAATGTAGAGATTCAGAAAGG + Intergenic
1097757465 12:63422701-63422723 AAAAATGCAGAGGTGCAGAGAGG + Intergenic
1097951493 12:65434103-65434125 AAAAAAGAAAAAATGGAGAAAGG - Intronic
1098219438 12:68252971-68252993 AACAATGCACAGAGGCATAAAGG + Intronic
1098374033 12:69793385-69793407 CAAAATGCACAGTGGTAGAATGG - Intronic
1098413287 12:70204295-70204317 AAAATTTTACAGATGGAGGAAGG + Intergenic
1098603846 12:72365976-72365998 GAAGATGCAAAGATGGAGAAAGG - Intronic
1099054490 12:77822003-77822025 AAAAATACACATCTGGAAAAAGG - Intergenic
1099468781 12:83020794-83020816 ACAAGTGAACAGATGTAGAAAGG + Intronic
1099711581 12:86232608-86232630 AAACATGAACAGATTGAGAAGGG + Intronic
1099740167 12:86624750-86624772 AGAAAAGCACAGACAGAGAAAGG + Intronic
1100095220 12:91025748-91025770 AAGAATGAAAAGATGCAGAATGG + Intergenic
1101634659 12:106528593-106528615 AGAAATGCAAAGATGGAGGTGGG + Intronic
1101698478 12:107149456-107149478 GTAAATGCTGAGATGGAGAAGGG - Intergenic
1101703622 12:107198985-107199007 AAAGATGTTCAGATGAAGAACGG + Intergenic
1102621660 12:114200700-114200722 AAAATTGTACAGATGGGGGATGG - Intergenic
1103542565 12:121676374-121676396 AACAAAGCACAGCAGGAGAAGGG - Intergenic
1104255813 12:127137019-127137041 AAAAGTAAAGAGATGGAGAAAGG - Intergenic
1104368143 12:128196357-128196379 AAGAATGCAGAGGTGGAGAGAGG + Intergenic
1104653088 12:130551676-130551698 GAAAATGCACAGATAGAGCAAGG + Intronic
1104709535 12:130975939-130975961 AAACATTCACAGAGGGAGGAAGG - Intronic
1106057219 13:26249694-26249716 ATGAATGAACAGATGGATAATGG - Intergenic
1106442105 13:29784663-29784685 AAAATTATAGAGATGGAGAATGG + Intronic
1106621913 13:31378414-31378436 AAAAATGCACAAAGGTACAAAGG + Intergenic
1107101913 13:36602300-36602322 AACAATGCACAATGGGAGAAAGG + Intergenic
1107191665 13:37595622-37595644 ACAAATGCATAGATGTAGACAGG - Intronic
1107462412 13:40616845-40616867 CAAAAGGGACAGATGGAGAAAGG + Intronic
1107731603 13:43354785-43354807 AAAAACCCACAGAAGCAGAAAGG - Intronic
1107926920 13:45272022-45272044 AAAAATGAAAAGATGAAAAAAGG - Intronic
1108106238 13:47013771-47013793 AAGAAGGAAGAGATGGAGAAAGG + Intergenic
1108274216 13:48791453-48791475 AACAATGCACAGCTGGGGAGAGG - Intergenic
1108463904 13:50695273-50695295 GAAAATACACAAATGGACAATGG + Intronic
1108505970 13:51112714-51112736 ATCAATTCACAGATGAAGAAGGG + Intergenic
1108671298 13:52691853-52691875 AAAAATGCACAGATGGAGAAAGG - Intronic
1108801080 13:54095372-54095394 AAAAATGTACATATGTACAACGG - Intergenic
1108999770 13:56783896-56783918 AAAAATGAACAAATTGAGCATGG + Intergenic
1110087361 13:71397869-71397891 AAAAAGGCACAGGTGAAAAACGG + Intergenic
1110517316 13:76429576-76429598 ACAAGTACACAGGTGGAGAAGGG + Intergenic
1110527894 13:76560765-76560787 TAAAATGCAAATATGGAGAGAGG - Intergenic
1110647168 13:77901134-77901156 AAAAATGCAGTGATGGCCAATGG + Exonic
1110844585 13:80179795-80179817 AAAAAAGCACAGAAGCAGGAAGG + Intergenic
1111220324 13:85196809-85196831 ACAAATACACAGATGGAAGATGG + Intergenic
1112002126 13:95220668-95220690 AAAAATGCACAGAGAGAGGAGGG + Intronic
1112676876 13:101711777-101711799 AAAAATGCACAGAAGGGAGATGG + Exonic
1112798327 13:103082251-103082273 TAAAAGGCACAGATCCAGAAAGG + Intergenic
1113334835 13:109367781-109367803 CTAAATGCACACAGGGAGAATGG + Intergenic
1113554087 13:111217262-111217284 AAAAATCCACTAATGGAGAGTGG + Intronic
1113710753 13:112463501-112463523 GAAAAGGCACAGATCAAGAAAGG + Intergenic
1113856932 13:113451881-113451903 AAAAGTGCACCGACGGAGATCGG - Intronic
1114216826 14:20663516-20663538 AGAGATGCACAGGTGGAGGAAGG - Intergenic
1114338961 14:21723333-21723355 GAAAATGCACAGAAAAAGAAAGG - Intergenic
1114376672 14:22153746-22153768 AAATAAGCACATATGGAGAATGG - Intergenic
1114696851 14:24633635-24633657 AGAAAAGCAGAGTTGGAGAATGG + Intronic
1114919882 14:27312858-27312880 CAAAATGCACAAATGAAGCAAGG - Intergenic
1115028847 14:28771074-28771096 AAATATACACAAATGGGGAATGG + Intergenic
1115189227 14:30729060-30729082 AAAAATGGACAAATGGACAAAGG - Intronic
1115208059 14:30934520-30934542 AACCATGTACAGATAGAGAATGG + Intronic
1115344193 14:32324794-32324816 GAGAATGCAGAGATGGAAAAAGG + Intergenic
1115461091 14:33661897-33661919 AAAAATGCATTGGTTGAGAAAGG - Intronic
1115678615 14:35711073-35711095 AAAAATGAAGAGATGGCAAAAGG - Intronic
1115993511 14:39173028-39173050 AAAAATGTAGAGATGAATAATGG - Intergenic
1116198841 14:41764286-41764308 AAAAATGCAAGGACAGAGAAAGG - Intronic
1116232722 14:42237847-42237869 AAAAAAGCAAAGAAGGATAAAGG - Intergenic
1116442755 14:44972720-44972742 AAAAGTAAAGAGATGGAGAAAGG - Intronic
1116508176 14:45711437-45711459 AAAAATTCACAAATTAAGAATGG - Intergenic
1117096822 14:52307073-52307095 AACAATGCACAGAAGAAAAATGG + Intergenic
1117200825 14:53388365-53388387 GAGAAAGCACAGCTGGAGAACGG - Intergenic
1117669475 14:58092124-58092146 AAAAATGAACAGATTGAGGTGGG - Intronic
1117896896 14:60496481-60496503 AAGAATGGTCACATGGAGAATGG - Intronic
1118122528 14:62861126-62861148 AAAGATGCAAAGCTGGACAAGGG + Intronic
1118179460 14:63477528-63477550 AAAAAAGCAGTAATGGAGAAAGG + Intronic
1118924719 14:70181645-70181667 ACAAATGCACAAAAGCAGAAAGG + Intronic
1119032009 14:71200142-71200164 CAAGATGCACAGATGCAGTAAGG + Intergenic
1119245777 14:73105861-73105883 AAAAAAGCAGAGATCGTGAAAGG + Exonic
1119464593 14:74845812-74845834 AAAAATGCATACATACAGAAAGG - Intronic
1119616585 14:76102743-76102765 ACAAATGCACAGCTTGAAAATGG + Intergenic
1120016006 14:79474294-79474316 AACACTGCACTAATGGAGAATGG + Intronic
1120135944 14:80868787-80868809 AAAAATGAAGGGATGGAAAAAGG + Intronic
1120465303 14:84848989-84849011 AAAACTGCACAAATGATGAAAGG - Intergenic
1120894138 14:89514736-89514758 CAAGATGCACAGATGGAGTGAGG - Intronic
1121030481 14:90654539-90654561 TAAAATGTGCAAATGGAGAAGGG + Intronic
1122005557 14:98700590-98700612 TGAAATGCAGAGATGGAGGAAGG + Intergenic
1122167388 14:99838536-99838558 AAAATTATGCAGATGGAGAAGGG - Intronic
1122345623 14:101057780-101057802 AAAAATGGACAGATGGGAAAAGG - Intergenic
1122698945 14:103574043-103574065 AAAAATGGAAAGACAGAGAAAGG + Intronic
1123452997 15:20385011-20385033 AAAAATCATCAGATGAAGAACGG - Intergenic
1123492558 15:20793889-20793911 AAAAGTGCAAGGATGAAGAAGGG + Intergenic
1123549059 15:21362981-21363003 AAAAGTGCAAGGATGAAGAAGGG + Intergenic
1123972212 15:25517902-25517924 AAAAATGCACAGAGGGGGCCGGG - Intergenic
1125473140 15:40024188-40024210 AAAAATAAAAGGATGGAGAAAGG - Intronic
1127531653 15:59849253-59849275 AAAAAAGCACAGGTGGAGGCGGG + Intergenic
1127703141 15:61521444-61521466 ATAAATGCAGAGATGTACAATGG + Intergenic
1128057177 15:64708879-64708901 AAAAATGTACATATAGACAACGG - Intergenic
1129025264 15:72566239-72566261 AAAAATGCACTGATGAAGCATGG + Intronic
1129485942 15:75872040-75872062 AAAGGTGCACACAGGGAGAAGGG + Intronic
1130265920 15:82403062-82403084 AAAGGTGCACACAGGGAGAAGGG + Intergenic
1130506101 15:84543823-84543845 AAAGGTGCACACAGGGAGAAGGG - Intergenic
1130763314 15:86843360-86843382 AATAATTCACAAATGGTGAAAGG + Intronic
1130825144 15:87536439-87536461 AAATATGTATAGATGGTGAAGGG - Intergenic
1131362929 15:91810199-91810221 AAAAATGTAAATATGCAGAATGG + Intergenic
1132000207 15:98171499-98171521 AAAATAGTACAAATGGAGAATGG - Intergenic
1202957393 15_KI270727v1_random:90202-90224 AAAAGTGCAAGGATGAAGAAGGG + Intergenic
1133518648 16:6534718-6534740 CAGAATGCAAAGAGGGAGAAGGG + Intronic
1134260973 16:12650603-12650625 AAAAATGTAGAGATGGGGTAGGG - Intergenic
1134630790 16:15754505-15754527 AAAAATCCACTGATGAAGTAGGG + Intronic
1135651748 16:24212435-24212457 AAAAAAGCACAGGAGGAGAGAGG - Intronic
1136109155 16:28053796-28053818 AAACAGACAGAGATGGAGAAAGG - Intronic
1136250142 16:28999019-28999041 AAAAAGGCAGAAAGGGAGAAAGG - Intergenic
1137264902 16:46860672-46860694 AAAAATGTAAAGCTTGAGAATGG - Intergenic
1137497555 16:48982507-48982529 AAAAAAGCACACTTGGAAAAAGG + Intergenic
1137579620 16:49625988-49626010 AAGAAGGCTCAGATGGAGAAAGG + Intronic
1138163432 16:54777362-54777384 AAAAATCCAGAAGTGGAGAACGG + Intergenic
1138537938 16:57669679-57669701 ATGAATGCGCAAATGGAGAATGG - Intronic
1138843415 16:60537129-60537151 CAAAATGAAGAGATGGAGGAAGG - Intergenic
1139823790 16:69741078-69741100 AAAAAAGCACAGATGGGGCTGGG + Intergenic
1140031895 16:71345597-71345619 AAAAGTGCACCGCTGGGGAAAGG + Intergenic
1140102871 16:71933518-71933540 TAAACTGAACAGAAGGAGAAAGG + Exonic
1140989247 16:80192318-80192340 ATAGATGCATAGAAGGAGAAGGG - Intergenic
1141283390 16:82649300-82649322 ATGAATGCATAGATGGAGGATGG + Intronic
1142680140 17:1542675-1542697 ACAGATGCACAGATGGGGAAGGG + Intronic
1142950008 17:3471155-3471177 AAAAATGGAGAGAGGGAGGAAGG + Intronic
1146451594 17:32978901-32978923 AAAAATGCACAGGTTGGGGACGG - Intronic
1147997981 17:44371686-44371708 AAAAAAGAAAAGAGGGAGAAAGG - Intergenic
1149183566 17:53970483-53970505 AAAAATGTGTAGATGGAGACTGG + Intergenic
1149256149 17:54829000-54829022 ATAAAGTCACAGAAGGAGAATGG + Intergenic
1149751620 17:59151428-59151450 AAACATGCATAGATGTAGAAAGG + Intronic
1150753686 17:67890465-67890487 TAAAATCCAGAGATGGAGAAGGG - Intronic
1151353377 17:73544599-73544621 ATACATGGACAGATGGATAATGG + Intronic
1151481611 17:74372926-74372948 AAAAACGGACAGATGGAGGCCGG + Intergenic
1151672989 17:75582568-75582590 CCAAAGGCCCAGATGGAGAATGG - Intergenic
1152175764 17:78786163-78786185 AAAGATGAAGAGATGGGGAAGGG - Intergenic
1153289996 18:3491812-3491834 AAAAATACACAGCTGGTAAAGGG + Intergenic
1154086922 18:11314454-11314476 AAATACTCAGAGATGGAGAAGGG + Intergenic
1154199480 18:12289348-12289370 AAAGATCCAGAGATGGGGAAGGG + Intergenic
1154323499 18:13372902-13372924 ACAAAGGCCCAGATGGTGAACGG - Intronic
1154931900 18:21007185-21007207 AAAAATGACTAAATGGAGAAAGG - Intronic
1155792529 18:29992099-29992121 AAAAATGTATTGATAGAGAAAGG - Intergenic
1156030869 18:32710771-32710793 AGAAATGGACAGATGGAGAGGGG + Intronic
1156093610 18:33501553-33501575 AAAAATGGAAATATGAAGAAAGG - Intergenic
1156474376 18:37396382-37396404 AAAAATTTACAGATGGAAAAAGG - Intronic
1156935297 18:42698376-42698398 AAAAATGAATAAATGGAGAAGGG - Intergenic
1157154816 18:45255151-45255173 AAAGATGCAGAGAAAGAGAAAGG - Intronic
1157398905 18:47369620-47369642 AAAAATCTAAAGCTGGAGAATGG - Intergenic
1157506989 18:48233743-48233765 AAAAAAGCACAGATGAATATGGG - Intronic
1157649221 18:49311176-49311198 CACAAGGCACAGCTGGAGAAGGG + Intronic
1157691044 18:49682164-49682186 AGAAATGGACAGTTGGAGACTGG - Intergenic
1160625105 18:80198735-80198757 AAGTATTCACATATGGAGAATGG + Intronic
1163587618 19:18172729-18172751 AAAAAGGCCCAGATGGAGGCTGG - Intronic
1164299018 19:23942815-23942837 AAAAGTGGAGAGATGGAAAAAGG - Intronic
1164516837 19:28943862-28943884 TACAATGCACAGAGGGAGCAGGG - Intergenic
1165317814 19:35067209-35067231 GAAGCTGCCCAGATGGAGAAAGG - Intergenic
1166049552 19:40249849-40249871 AGAAAAGCACAGCTGGGGAAGGG + Intronic
1166328694 19:42066481-42066503 AAAAAAGCAAAGAGAGAGAAGGG + Intronic
1166449513 19:42886233-42886255 ATAAATGAAAAGAGGGAGAAGGG - Intronic
1166460811 19:42986526-42986548 ATAAATGAAAAGAGGGAGAAGGG - Intronic
1166467607 19:43046710-43046732 TAAAAGGCACAGCTGGAGGATGG - Intronic
1166474227 19:43107499-43107521 TAAAAGGCACAGCTGGAGGATGG - Intronic
1166478106 19:43146516-43146538 ATAAATGAAAAGAGGGAGAAGGG - Intronic
1166488194 19:43232576-43232598 CAAAAGGCACAGCTGGAGGATGG - Intronic
1166494861 19:43293056-43293078 CAAAAGGCACAGCTGGAGGATGG - Intergenic
1166577751 19:43858948-43858970 AAAAGTGAAGAGATGGAAAAAGG + Intergenic
1167686398 19:50959504-50959526 ACAAAGGCACAGAGAGAGAATGG + Intronic
1167977678 19:53243714-53243736 AAAAATGTAAAGATGTACAAGGG + Intronic
1168544381 19:57238640-57238662 AAATGAGCATAGATGGAGAAAGG - Intergenic
925875133 2:8304950-8304972 AAAACTGCACAGCAGGTGAATGG - Intergenic
926347729 2:11963854-11963876 GAAAATGCACTGAAGAAGAAAGG + Intergenic
926427625 2:12753797-12753819 AACAATGCATAGAAGGACAATGG - Intergenic
926666665 2:15531899-15531921 AAATAATCAGAGATGGAGAATGG - Intronic
926930319 2:18031536-18031558 AAAAGTGCAGAGAGGGAGAGAGG - Intronic
927709381 2:25315276-25315298 AAGAATGCACCCCTGGAGAAAGG - Intronic
927754995 2:25701546-25701568 AAAAAAGCACAGATCTGGAAAGG + Intergenic
928500342 2:31886074-31886096 AAAAATGCACAGAGAGCCAATGG + Intronic
928941855 2:36734755-36734777 AGAAATGCAAAGAAGGAAAAAGG - Intronic
929001078 2:37347396-37347418 AGAAAAGCACAGAAGAAGAAAGG - Intronic
929209333 2:39336919-39336941 AAAAATGCACAGAGATATAAAGG - Exonic
930368885 2:50479237-50479259 GAAAATGCAGAGTTGGGGAAAGG - Intronic
930576828 2:53160830-53160852 GAAAATGCAAAGTTGCAGAAGGG - Intergenic
930766247 2:55088740-55088762 AAAAAAGCAGAGATGGATCAAGG + Intronic
930998259 2:57749076-57749098 AAAAATGCACAGTTTCATAAGGG + Intergenic
931269007 2:60685567-60685589 ACAGATGCCCAGCTGGAGAAAGG + Intergenic
932438490 2:71717105-71717127 ACAATTGCACAGCTGGAGCAGGG - Intergenic
932471174 2:71959856-71959878 AGAAATGCACAGATCCAGCAGGG - Intergenic
932936846 2:76113452-76113474 AAAAATGCAGAGTTTGAAAAGGG - Intergenic
933465062 2:82641364-82641386 AAAAATGCTCAGAGAGGGAAAGG + Intergenic
933481663 2:82865440-82865462 AAACATGCATAGATAGATAAGGG + Intergenic
933929947 2:87139913-87139935 AAAAAAAAAGAGATGGAGAAAGG - Intergenic
934001280 2:87715698-87715720 AAAAAAAAAGAGATGGAGAAAGG - Intergenic
934021101 2:87953500-87953522 ATAAATGCACAGATGAAAAGAGG - Intergenic
935197425 2:100825882-100825904 AAGAATGCAAAGGTGAAGAAGGG + Intronic
935448776 2:103186458-103186480 AAAAATTTAAAAATGGAGAAAGG + Intergenic
935554720 2:104496762-104496784 AAATAGACACAGATAGAGAAGGG - Intergenic
936362992 2:111823502-111823524 AAAAAAAAAGAGATGGAGAAAGG + Intronic
936816084 2:116462786-116462808 AAATATGCCCAAAAGGAGAATGG + Intergenic
937059011 2:118967664-118967686 AGAAATGCCCAGATGAACAATGG - Intronic
937370456 2:121293921-121293943 AAACTTGCACAGCTGGAGGACGG + Intergenic
937889179 2:126923435-126923457 AAAAATACACAGAAAGAAAAGGG - Intergenic
937901643 2:127024561-127024583 AAAAATGTACAAAAGGAGACTGG + Intergenic
938206251 2:129426721-129426743 AGAACTGAACAGATGGAGGAAGG - Intergenic
938580117 2:132638120-132638142 AAAAAGAGACAGAGGGAGAAAGG + Intronic
938928635 2:136066747-136066769 CAAGATTCACAGATGGAGGATGG + Intergenic
940032288 2:149276412-149276434 AACAATACAAAGATGAAGAAGGG + Intergenic
940094418 2:149958138-149958160 CAAAAAGAACACATGGAGAAAGG - Intergenic
940391658 2:153139576-153139598 AGATATGAACAGATGGAGATGGG + Intergenic
940449434 2:153818783-153818805 TAAAATGCTCAGATGGAGCAGGG - Intergenic
940761122 2:157740516-157740538 AAAAATTGAGAGATGGTGAAGGG - Intronic
941210167 2:162628216-162628238 TAAAATGAACACATGGAAAAAGG + Intronic
941322600 2:164073872-164073894 AAAAAAGCACAGGGGAAGAAAGG + Intergenic
941889309 2:170561521-170561543 AAAAATGCACAAATGTACACCGG + Intronic
942123092 2:172797976-172797998 CAAGATACAAAGATGGAGAAAGG - Intronic
943040509 2:182798956-182798978 AAAAATGCACATATTCAGTATGG + Intergenic
943056246 2:182984237-182984259 AAAAATAGAAAGATGGGGAAAGG + Intronic
943171983 2:184413476-184413498 ATAATTTCACAGATGGAAAATGG + Intergenic
943174381 2:184451171-184451193 AAAAATGCAGATAAGGACAAAGG - Intergenic
943693694 2:190898063-190898085 AAAAATGCACGAATAAAGAAAGG - Intronic
943990429 2:194682870-194682892 GAAAAGGTAAAGATGGAGAAAGG + Intergenic
945117671 2:206424958-206424980 AAAAATGCAGAAAAGTAGAAAGG + Intergenic
945246357 2:207720759-207720781 AGAAATACACAAAGGGAGAAAGG + Intronic
945344651 2:208698877-208698899 AAACATGCACAGATGAAGCAAGG - Intronic
945514969 2:210752258-210752280 AAAAATCCACTTATAGAGAAGGG + Intergenic
946981802 2:225225958-225225980 AAAACTACAGAGATGGAGAAAGG + Intergenic
947079999 2:226385485-226385507 AAAAAAGCACAGTTGGAGGATGG - Intergenic
947106275 2:226671006-226671028 AAAGTTGCACAGCTGGTGAATGG - Intergenic
947766884 2:232643644-232643666 AAAAAAACACAGATGGACATTGG - Intronic
947899651 2:233711003-233711025 AAAAATTCAGAGATAGAAAAAGG - Intronic
947941019 2:234054939-234054961 AAAAATGCAAAGAGGTTGAAAGG - Intronic
948323726 2:237093831-237093853 AAAATTACAAAGATGGAAAAAGG - Intronic
948730518 2:239960988-239961010 AAAATTGCACAGTGGAAGAAGGG - Exonic
1169331119 20:4717209-4717231 GAAAATGTCCAAATGGAGAAAGG - Intergenic
1169829795 20:9811771-9811793 AACAATGCAAAGTTGGACAATGG + Intronic
1169966522 20:11223846-11223868 AAAAATGGAAAGATGGTTAAAGG + Intergenic
1170559955 20:17548726-17548748 AAAAATACACAGTTGGAGACTGG - Intronic
1170839994 20:19916903-19916925 TCAAATGCACAGATGGAGCCAGG - Intronic
1170882372 20:20308418-20308440 AAAGGTGTACAGATGGGGAAGGG + Intronic
1170988781 20:21283172-21283194 GAAAAAGAACAAATGGAGAAAGG - Intergenic
1171135148 20:22688853-22688875 CAGCATGCACAGATGGGGAAAGG - Intergenic
1171332374 20:24351802-24351824 AACATTGAATAGATGGAGAATGG - Intergenic
1172257633 20:33533675-33533697 AAAAAAGCACAGATGGGAACCGG + Intronic
1172405102 20:34682427-34682449 ACAAATACCCAAATGGAGAAAGG + Intergenic
1172510241 20:35495772-35495794 AAAAAGACACAGTTTGAGAAGGG + Intronic
1173022597 20:39279663-39279685 ATAAATAAACAGATGGAGCATGG + Intergenic
1173076952 20:39828347-39828369 AGACATGCACACAGGGAGAATGG + Intergenic
1173249052 20:41354952-41354974 AAAAACCCACAGCTGGAGACAGG - Intronic
1174225615 20:48996998-48997020 AAAAAGGGAAAGATGGACAATGG - Intronic
1174288176 20:49486808-49486830 ATAAATGAACTGATGGAGAAAGG - Intergenic
1174367466 20:50065207-50065229 AAAGATGCACAGCTGGGGAGTGG - Intergenic
1174561045 20:51431079-51431101 AAATAAGCACATATAGAGAATGG - Intronic
1176446084 21:6821936-6821958 AAAAGTGCAAGGATGAAGAAGGG - Intergenic
1176824250 21:13686969-13686991 AAAAGTGCAAGGATGAAGAAGGG - Intergenic
1177928061 21:27243649-27243671 AAAAATGCACATATGAACATGGG - Intergenic
1178477561 21:32950653-32950675 GAAAATGCACAAATGAAGAAGGG - Intergenic
1179086995 21:38226848-38226870 GAAAATGCACTGAAGGAGGATGG - Intronic
1180651079 22:17377693-17377715 AAATATGCAAATATGGAGGAAGG - Intronic
1180990424 22:19932477-19932499 AAAAAGGGAGGGATGGAGAAGGG + Intronic
1183455819 22:37922513-37922535 ACAATGGCACAGATGGAGAGGGG - Intronic
1184163680 22:42714819-42714841 AAAAATGCACTCAGGGAGATGGG + Intronic
1184624294 22:45711324-45711346 AAAATTACAGAAATGGAGAACGG + Intronic
1185409828 22:50676029-50676051 AAGACTTCACAGCTGGAGAAAGG - Intergenic
949151387 3:772158-772180 GACAATGCACAGTGGGAGAAAGG + Intergenic
949811109 3:8007215-8007237 AAAAATGAAGACAAGGAGAAAGG + Intergenic
949940457 3:9150466-9150488 TTCCATGCACAGATGGAGAAAGG + Intronic
950210922 3:11122473-11122495 AAAACTGCAAAAAAGGAGAAAGG + Intergenic
950575606 3:13830403-13830425 AAACATGAACAGATGGGGCATGG - Intronic
950581077 3:13862513-13862535 GAAAATATACAGATGGAAAAAGG + Intronic
950812915 3:15666814-15666836 AGATTTGAACAGATGGAGAAGGG - Intergenic
950891719 3:16410066-16410088 AAAAAGGCACTGATGAAAAATGG + Intronic
951268666 3:20599839-20599861 CAAAATAAAGAGATGGAGAAAGG - Intergenic
951987797 3:28640300-28640322 TAAAATAAAAAGATGGAGAAGGG - Intergenic
951993003 3:28696856-28696878 AAGATTTCACAGATTGAGAAAGG - Intergenic
952106791 3:30079257-30079279 AAAAAGAGAGAGATGGAGAAGGG - Intergenic
952691731 3:36215006-36215028 GAAAAGGCACAGATACAGAAGGG - Intergenic
952809316 3:37387257-37387279 AAAACTGGGCAGAGGGAGAAAGG - Intronic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
954091483 3:48287804-48287826 ACATAAGCACAGATGGAGATAGG + Intronic
955411095 3:58655989-58656011 AAAAGTGAACAGATAGAGGATGG - Intronic
955559848 3:60177026-60177048 AAAAATGCTCATAGGGAGACTGG + Intronic
955776575 3:62440216-62440238 AAAAAGGAGGAGATGGAGAAAGG - Intronic
956055367 3:65293020-65293042 AAAATAACACAGATAGAGAAAGG + Intergenic
956541689 3:70347465-70347487 AACACAGCAGAGATGGAGAAGGG + Intergenic
957417174 3:79920188-79920210 AAAAATACAGAGCTGGACAATGG - Intergenic
957546711 3:81647382-81647404 AAACATATTCAGATGGAGAAAGG - Intronic
957594001 3:82236992-82237014 AAGGATGCAAAGATGGAGAAAGG + Intergenic
957632499 3:82735331-82735353 AAAAATACACAAATGCATAAAGG - Intergenic
957916047 3:86689044-86689066 GAAAATGCAGGGATTGAGAAAGG + Intergenic
957947106 3:87079086-87079108 AAAAATGCACATACTAAGAATGG + Intergenic
958433353 3:94068036-94068058 ACTACTGCACAGAGGGAGAAGGG - Intronic
958465707 3:94455010-94455032 AAAAGTGAAGACATGGAGAAAGG - Intergenic
958501934 3:94922278-94922300 AAAAATGAACAAGTGAAGAAAGG - Intergenic
958634125 3:96721000-96721022 AAATCTTCAGAGATGGAGAAAGG + Intergenic
958733781 3:97987539-97987561 AAAAATGAACAAATAGAGAGAGG + Intronic
959134571 3:102400788-102400810 AAAAATACAAAGAGGAAGAATGG + Intronic
959297149 3:104550906-104550928 AAAAATGCAAAGTTGGGGAGAGG - Intergenic
959366843 3:105471397-105471419 AAAAGTGCACAAATGGAAAATGG + Intronic
959625238 3:108442321-108442343 AAAGAAGCACAGATGGAGAGAGG + Intronic
960545472 3:118909581-118909603 ATTAAGGCATAGATGGAGAAGGG + Intronic
961957677 3:130821005-130821027 CAAAAGGGGCAGATGGAGAAAGG + Intergenic
962052948 3:131837485-131837507 AAAATTACAGTGATGGAGAACGG + Intronic
962065820 3:131979630-131979652 AAAGATGCAGAGCTGCAGAATGG - Intronic
962239018 3:133734576-133734598 AAAACTAAACAGATGAAGAAAGG + Intergenic
962719319 3:138158071-138158093 AATAAAGCACAGATATAGAAAGG - Intergenic
963801725 3:149682991-149683013 AAAAAGACAAAGATGGGGAAAGG + Intronic
964159947 3:153634753-153634775 AAAAATTTACAGACAGAGAAAGG - Intergenic
964516265 3:157511792-157511814 ATAAATACATAGATGTAGAAAGG - Intronic
964700396 3:159559201-159559223 AACTCTGCACAGATAGAGAAAGG + Intronic
965213533 3:165828895-165828917 AAGACTGCTCAGGTGGAGAACGG + Intronic
966026914 3:175295390-175295412 AAAAAAACACAGAAGTAGAAAGG - Intronic
966175081 3:177129847-177129869 AAAAATGCACATATCCAGCAGGG + Intronic
967012554 3:185450181-185450203 AAAATTGCACAGATAGAAAGGGG - Intronic
967293010 3:187940076-187940098 AAAAATGAGCAGACTGAGAAGGG + Intergenic
967825957 3:193877579-193877601 AAAAAAGAAAAGATGGAAAAAGG + Intergenic
967864965 3:194182466-194182488 AAAAAAGCTGAGAAGGAGAAAGG + Intergenic
967885210 3:194328965-194328987 AAAAATGATCAGTTGGAGGAAGG - Intergenic
967941977 3:194773136-194773158 AGAAATGCCCAGATTCAGAATGG - Intergenic
968001031 3:195206944-195206966 AAATATCCACAGAAGGAGAGAGG - Intronic
969935011 4:10671654-10671676 GAAAATGCACACATGAGGAAGGG - Intronic
970051640 4:11921160-11921182 AAAAAGGCAAAGATGCAGACCGG + Intergenic
970648359 4:18148978-18149000 AAACATGTACCTATGGAGAATGG + Intergenic
971084359 4:23254095-23254117 AAAAATGCACAAAGGGACATAGG - Intergenic
971547644 4:27907170-27907192 AACATTGCACAGATAGATAATGG - Intergenic
971875839 4:32307492-32307514 TAAAATACATATATGGAGAAGGG + Intergenic
971971120 4:33622464-33622486 AAAAATATAAAGATGGTGAAAGG - Intergenic
972262212 4:37420708-37420730 AAAAAGGCACAAAAGGAGCAGGG + Intronic
972340130 4:38145353-38145375 AAAAATGCTGTGATGGATAATGG + Intergenic
973203067 4:47527186-47527208 AAAGACACATAGATGGAGAAAGG + Intronic
974222082 4:58987962-58987984 AAAAATGCACAGACTGTTAAAGG + Intergenic
974334824 4:60528574-60528596 AAAAAGGCTCAGATGCACAAAGG + Intergenic
974398005 4:61365033-61365055 AAAAATGCTTATCTGGAGAAGGG + Intronic
974436864 4:61867789-61867811 AAATATGCACAGTTTGAGGATGG - Intronic
974694822 4:65352770-65352792 AAAAATGCAGAGAAGTAGAAGGG - Intronic
974815495 4:66998448-66998470 AAAGATGTACAGAGTGAGAAGGG + Intergenic
975382046 4:73711903-73711925 AATAATGCAGAGAAGGTGAAAGG + Intergenic
976016992 4:80567682-80567704 AAAATTGCATAGAAGGAAAATGG - Intronic
976297418 4:83486050-83486072 AAAGATGAACAGAAGGAAAAGGG + Intronic
976437252 4:85032441-85032463 CAAAATGCACAAATGAAGCAAGG + Intergenic
977480955 4:97574736-97574758 AAAAATCCACAGAAGCAGAAAGG - Intronic
978062940 4:104360571-104360593 AAAAATGCTCAGAAACAGAAAGG + Intergenic
978184320 4:105839123-105839145 AAATATGCACAGATATGGAAAGG + Intronic
978203640 4:106052724-106052746 AAAAATGTACAGAGAAAGAATGG - Intronic
978542617 4:109835000-109835022 AAAAATGGCCAGATGATGAACGG - Intronic
979040794 4:115791051-115791073 GAAAATGCAAGGATGGAAAAAGG - Intergenic
979815983 4:125104632-125104654 AAAAATAAACAGCTGCAGAAAGG + Intergenic
980628235 4:135404140-135404162 AAAAATGCAAAAAGGGAGACTGG + Intergenic
981230208 4:142344555-142344577 AAAAGTGTACAGCTGGAAAAAGG - Intronic
981404627 4:144353796-144353818 AGAAATACACAGATGTAGACGGG + Intergenic
981453165 4:144921999-144922021 TAAAATGTTCAGATGGATAAAGG + Intergenic
981492603 4:145356177-145356199 AAAGATACACAGATTGGGAAAGG + Intergenic
981628470 4:146789027-146789049 ATAAATTCACAGATGGAATATGG - Intronic
982026480 4:151257465-151257487 AAAAATGAACAGAGTTAGAAGGG - Intronic
982850622 4:160310828-160310850 AAATAAACACAGCTGGAGAAAGG - Intergenic
983249965 4:165332138-165332160 AAAAATGTACATATGGATAAAGG - Intronic
983597903 4:169491157-169491179 AAAAAAAGAGAGATGGAGAAAGG + Intronic
983613948 4:169680176-169680198 AAAAATGTAAAGACAGAGAAAGG + Exonic
984083558 4:175280469-175280491 AAAAATGTGCAGATGCAGACTGG - Intergenic
984865127 4:184274638-184274660 CAGTATGCACAGATGGTGAAAGG - Intergenic
985314430 4:188640493-188640515 AGGAAGGGACAGATGGAGAAAGG - Intergenic
986547655 5:8916394-8916416 AACTATGCACAGAAGTAGAAAGG - Intergenic
987550070 5:19368090-19368112 AAAAATGCAAGGATGAAGAAGGG + Intergenic
988230994 5:28479427-28479449 AAAAAAGCAGAGAAGGAAAAGGG - Intergenic
988391906 5:30644893-30644915 TAAAATGCACACATGTAAAATGG + Intergenic
988586406 5:32511313-32511335 AAAAATACACAGAAGGATATGGG + Intergenic
988717133 5:33839444-33839466 AGTAATGCACAGATGTGGAAAGG - Intronic
989043379 5:37250956-37250978 AAAAGTGCAGAGAGGGTGAAAGG - Intergenic
990156961 5:52888408-52888430 AAAATTGCTCAGACGGGGAAGGG - Intronic
990166042 5:52994252-52994274 AAAAATCCAAACATGGGGAAAGG + Intronic
990387908 5:55286263-55286285 AAAAAAGAACAGGTGAAGAAAGG + Intronic
991966697 5:72098798-72098820 CAACAGGCAGAGATGGAGAAAGG - Intergenic
992167365 5:74067848-74067870 AAAAAAGCACCCATGGAGAAGGG - Intergenic
992462207 5:76971799-76971821 AAGATTACAGAGATGGAGAATGG - Intronic
992872491 5:81021112-81021134 AGAAATGAAAACATGGAGAATGG + Intronic
993123873 5:83808132-83808154 AAAGATGCAAAAATAGAGAATGG - Intergenic
993492728 5:88571432-88571454 AAATATCCATAGGTGGAGAAGGG + Intergenic
993953035 5:94199471-94199493 AAAAGTGCTCTGATGGGGAAGGG + Intronic
994260811 5:97656390-97656412 AAACATGCACAGAAGGAAGAGGG + Intergenic
995023015 5:107387146-107387168 AAACATGCAGAGAAGAAGAAAGG + Intronic
995288413 5:110419193-110419215 AAGAAAGCAAAGATGGAGGAAGG + Intronic
995404874 5:111783600-111783622 AAACTTCCTCAGATGGAGAAGGG - Intronic
995656296 5:114430565-114430587 AATAGTACACAGATTGAGAAGGG - Intronic
996848931 5:127931492-127931514 CAATATGCACAGCTGGAGGAGGG - Intergenic
996923551 5:128796773-128796795 AACTAGGCACAGGTGGAGAAGGG - Intronic
997084057 5:130775398-130775420 AAAAAGGCACTCAAGGAGAAGGG + Intergenic
997173538 5:131750302-131750324 AAAAACGCAAAGAAGGAGAGTGG + Intronic
997572293 5:134940116-134940138 AGAAGTCCACAGATAGAGAAAGG - Intronic
998344811 5:141452570-141452592 AAAAATACAAAGATGGAAAGGGG - Intronic
999648942 5:153746766-153746788 AAAAATACACAGAAGGAAATGGG + Intronic
1000689686 5:164301078-164301100 GAACATGCTCATATGGAGAAAGG + Intergenic
1000769595 5:165336268-165336290 TAAATTCCACAGATTGAGAATGG + Intergenic
1000964034 5:167633677-167633699 AAAAAAGAAAAGAGGGAGAAAGG - Intronic
1001330761 5:170760765-170760787 GAAAATGCACAGATGGACCTAGG - Intergenic
1001389024 5:171363544-171363566 AAAAAAGGACAGAGAGAGAAAGG + Intergenic
1004239945 6:13911917-13911939 CAAAATGCATAGATGGTGGAGGG + Intergenic
1004738769 6:18435403-18435425 AAAAATGAATAAATAGAGAAGGG + Intronic
1004964609 6:20834185-20834207 AAAAATTCCCAGGTGCAGAAAGG - Intronic
1005267236 6:24125276-24125298 AAAAAAGCACAAATGCATAAAGG - Intergenic
1006976191 6:38104244-38104266 AAAAAGGCACAGATGAGGATGGG - Intronic
1007868682 6:45006737-45006759 AAAAGTTTAGAGATGGAGAAGGG - Intronic
1007913404 6:45538053-45538075 AGAAGTGGACAAATGGAGAAGGG - Intronic
1008131640 6:47725900-47725922 AAAAACAGACAGATGGGGAAGGG - Intergenic
1008764417 6:54893897-54893919 CAAAATGGACAGAAGTAGAATGG - Intronic
1009704349 6:67226519-67226541 GAAAATTCAGAGTTGGAGAAGGG - Intergenic
1010009534 6:71034462-71034484 AAAAATGATCATATGGAGCAAGG - Intergenic
1010142232 6:72624080-72624102 TACAATGCACACAAGGAGAACGG + Intronic
1010327692 6:74583998-74584020 AAAAATGATCAGAAGGAGGAAGG + Intergenic
1010391885 6:75347089-75347111 TTCAATGCACAGAGGGAGAAAGG - Intronic
1010959675 6:82131678-82131700 AGAAATGCACAGCTAGAGAGAGG + Intergenic
1011061652 6:83276499-83276521 AAAAATGCACAGATCAAAAGTGG + Intronic
1011538447 6:88403818-88403840 GAAATTAAACAGATGGAGAAGGG - Intergenic
1012196436 6:96347345-96347367 TAAAATGAGCAAATGGAGAATGG - Intergenic
1012253003 6:97000044-97000066 AAGAATGCAAAGATGGCCAATGG + Intronic
1012563738 6:100619596-100619618 AAAAATGTACAGATGATGTATGG + Intronic
1012862150 6:104572800-104572822 AAATATGAACATATTGAGAAAGG + Intergenic
1013460254 6:110367793-110367815 GAAAATGCACAGTTGGGCAATGG - Intergenic
1013486776 6:110604247-110604269 AAAAATGGACTAATGCAGAAAGG + Intergenic
1013565173 6:111351901-111351923 AACGGTGCCCAGATGGAGAAGGG + Intronic
1014347197 6:120287388-120287410 ACAAATCCACAGAAGGAAAAGGG - Intergenic
1014544659 6:122719906-122719928 AAAAATACACAGAAGGATATAGG + Intronic
1015203441 6:130608178-130608200 AAAAAAGAACAGAAGTAGAAAGG + Intergenic
1015435422 6:133180983-133181005 AACAAAGCTCAGATGGAAAAGGG - Intergenic
1015478789 6:133683566-133683588 AGAAAAGCAAAGATGGAAAAGGG + Intergenic
1017561688 6:155635082-155635104 GAAAATGCAGAAAAGGAGAAAGG + Intergenic
1017596423 6:156033974-156033996 AAAAATCCACAGATCCAGGAAGG - Intergenic
1017612304 6:156201566-156201588 AAACATCCACTGATGGATAAAGG + Intergenic
1018234087 6:161705795-161705817 AGAAATGCAGAGAATGAGAATGG - Intronic
1018544829 6:164923981-164924003 AAAAAGTCACTCATGGAGAATGG + Intergenic
1018775172 6:167008258-167008280 AAAATTCCACAGCTGGGGAAGGG - Intronic
1020352022 7:7230981-7231003 AAAAATTCAGAGATGTAGGAAGG - Intronic
1020506821 7:9000955-9000977 AAAAATACACAAATGGAGAAAGG + Intergenic
1020572455 7:9883150-9883172 GAAAATGCGGAGATGGAGATTGG + Intergenic
1020733588 7:11916501-11916523 AAAAATGCACAGATTGGGGCTGG + Intergenic
1020831984 7:13103899-13103921 AGACATGCACAGAGGGATAACGG + Intergenic
1021055996 7:16046938-16046960 AAAGATGAACAGGTGGAGTAGGG + Intergenic
1021456388 7:20833551-20833573 AAAATTATAGAGATGGAGAACGG + Intergenic
1022606710 7:31822422-31822444 ACAAATGCACATATGAACAAAGG + Intronic
1023165664 7:37341160-37341182 AAAGCTCCACAGATTGAGAAGGG + Intronic
1023701937 7:42900913-42900935 AAAAAAGGAAAGAGGGAGAAAGG + Intergenic
1024182588 7:46910806-46910828 AAAAATGCAAAGATGGTACACGG + Intergenic
1024314768 7:48005423-48005445 AGAAAGGGACAGAAGGAGAATGG - Intronic
1024562579 7:50656735-50656757 GAGAATGCAGAGGTGGAGAAAGG + Intronic
1024690036 7:51790173-51790195 AAAAATGAAGAATTGGAGAAAGG + Intergenic
1025614091 7:63103213-63103235 AGAGATGTACAGATGGTGAAAGG - Intergenic
1026621032 7:71950106-71950128 CAAAATGCACAAATGAAGCAAGG - Intronic
1027593419 7:80142169-80142191 AAAAATGCAGAAATGGGCAATGG - Intronic
1027722210 7:81758447-81758469 AAAAATAAACAGAGGGAGGAAGG + Intronic
1027830263 7:83168004-83168026 AAAAATGCACAGATGGATAGAGG - Intergenic
1028444472 7:90904563-90904585 AAAAATACAAAGATGAAAAATGG + Intronic
1028714526 7:93949016-93949038 AAAAAGGGAGAGAGGGAGAAAGG + Intergenic
1028726891 7:94097945-94097967 AAAAAGGCATATATGTAGAAAGG + Intergenic
1029789800 7:102830315-102830337 AAGCAGGCACAGATGGAGACTGG - Intronic
1030487137 7:110183750-110183772 AACAATGAACAGATTGAAAAGGG - Intergenic
1030733898 7:113021267-113021289 AAATAAGCACATATGGAGAATGG + Intergenic
1030811376 7:113976374-113976396 AAATAAGCACAGATGGAGAGTGG - Intronic
1030908203 7:115212668-115212690 ATAAATGCACAGTGGGAGAATGG + Intergenic
1031396285 7:121278262-121278284 AAAGAAGGACAGTTGGAGAAAGG + Intronic
1031488740 7:122362119-122362141 AAAAATGAACAGATAATGAAAGG + Intronic
1032231729 7:130080245-130080267 AAAAATGCATAGAAAAAGAAAGG - Intronic
1032951103 7:136914177-136914199 AAAATTGCACAGACTGGGAAAGG - Intronic
1033143585 7:138851057-138851079 AAAAATGTAAAGATACAGAAAGG - Intronic
1033305963 7:140225937-140225959 AGATATGCACACAGGGAGAATGG - Intergenic
1033684967 7:143630462-143630484 AAAAATGCACAGAAGGAAGAAGG - Intronic
1033688140 7:143709681-143709703 AAAAATGCACAGAAGGAAGAAGG - Intronic
1033699646 7:143827159-143827181 AAAAATGCACAGAAGGAAGAAGG + Intergenic
1033813569 7:145046173-145046195 GAGAATGCACAGCTGGAGCATGG + Intergenic
1034516782 7:151587314-151587336 ATAAACAAACAGATGGAGAAGGG + Intronic
1035252182 7:157604703-157604725 AAAAATGTACTGGTGGAGACTGG + Intronic
1035797366 8:2370678-2370700 ACAAGACCACAGATGGAGAAGGG - Intergenic
1036610054 8:10341920-10341942 GGAAATGCACTGATGGAAAATGG - Intronic
1036645623 8:10610156-10610178 AAGAAGGAACAGAAGGAGAAGGG - Exonic
1036803374 8:11809191-11809213 AGAAATGCAAAGTTGGATAAGGG - Intronic
1037402642 8:18508331-18508353 AAAAATGCAAAGGAGAAGAAAGG + Intergenic
1037564480 8:20105935-20105957 AAGGCTGCACAGAGGGAGAAGGG + Intergenic
1037612038 8:20483994-20484016 AAAAGGACACAGAGGGAGAAAGG - Intergenic
1037769941 8:21792592-21792614 ACAAAGGCACAGTGGGAGAAAGG + Intronic
1037793663 8:21972160-21972182 AAAAAAGCTAAGATGGAAAAGGG - Intronic
1038256884 8:25958422-25958444 AATAAAGTGCAGATGGAGAAAGG - Intronic
1038421479 8:27436771-27436793 AAAAATCCAATGATAGAGAAAGG + Intronic
1038427768 8:27475602-27475624 AAAAATCTACAGATGGACAGTGG + Intronic
1039250180 8:35654956-35654978 AATGATGCACAGATGGAAAGTGG + Intronic
1041389213 8:57334149-57334171 AAGGAAGCACAGACGGAGAATGG - Intergenic
1041487735 8:58397255-58397277 AAAAATGACCAGATAGAGCAGGG - Intergenic
1041540773 8:58982389-58982411 AAGAATGAAAAGATGGAGATAGG - Intronic
1041980378 8:63851353-63851375 AATATCGCACAGATGGAGGATGG - Intergenic
1042374823 8:68038414-68038436 AGAAATGCACTGATGGATGATGG - Intronic
1044341071 8:91046893-91046915 AAAAGGGCACGGATGCAGAAAGG + Intergenic
1044614830 8:94129252-94129274 GAAAAGGCACAGAGGCAGAAGGG + Intronic
1045019062 8:98025771-98025793 AAAAATGGACAGATCCAAAATGG - Intronic
1046015550 8:108600311-108600333 AAACATGCAAAGCTGGAGAAAGG + Intergenic
1046336922 8:112802761-112802783 AAAAAAGCAAAGATCAAGAAGGG - Intronic
1046586324 8:116152957-116152979 AAAACTGCATAAATGAAGAAGGG - Intergenic
1046969637 8:120207405-120207427 AAAAATGCACAAATAGCAAAAGG - Intronic
1047004652 8:120607882-120607904 AAGAATGCACAGTTCGTGAAAGG + Intronic
1047168398 8:122466129-122466151 AAAAATGAAGAGATTAAGAAGGG + Intergenic
1047717069 8:127605348-127605370 AGAAATGCCCATATGGAGCATGG - Intergenic
1048525270 8:135196669-135196691 AAATTTGCACAGATAGAAAAAGG - Intergenic
1049956408 9:696934-696956 ATTGATGCACAGATGAAGAAAGG + Intronic
1050125606 9:2353677-2353699 AAACAAGCACACAAGGAGAAAGG - Intergenic
1050358861 9:4809026-4809048 AAAAGTGCACATATAGAAAAAGG - Intronic
1050897088 9:10897530-10897552 GAAAATGCAAAAATTGAGAAAGG + Intergenic
1051037555 9:12766892-12766914 AAAAAATCAGAGACGGAGAATGG + Intergenic
1051240298 9:15047908-15047930 AAAAATGTAAAGACAGAGAAAGG - Intergenic
1051931310 9:22389565-22389587 CAAGATGCAAATATGGAGAAAGG + Intergenic
1052771337 9:32693738-32693760 AAATAAGCACACATGGAGAATGG - Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053109826 9:35448794-35448816 AATAATGGTCAGATGGTGAAAGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1055302413 9:74896113-74896135 AAAAATTTACATATGTAGAATGG + Intergenic
1055664884 9:78543387-78543409 AAAAAGTCACAGAAGGAAAAAGG - Intergenic
1055776227 9:79769690-79769712 AAAAAAGCATCCATGGAGAAAGG - Intergenic
1056297152 9:85204733-85204755 AAAAGTGCACAGAGGGAGACAGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057394687 9:94669335-94669357 AAACTTGCACAGATGGGGAGGGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1057961011 9:99457386-99457408 AAAGAAGCACAAGTGGAGAATGG + Intergenic
1058338063 9:103857926-103857948 AAAATGGCAAAGATGAAGAATGG - Intergenic
1058405729 9:104671889-104671911 AAAAAAGCAAAGCTGGAAAATGG - Intergenic
1058557944 9:106190434-106190456 AACAAAGCAAAAATGGAGAAAGG - Intergenic
1058805717 9:108589490-108589512 GAAAATGTAAAGATGGAGAAGGG + Intergenic
1059215791 9:112560919-112560941 AAGAATTCACAGATGAAGAAGGG - Intronic
1059913543 9:119073941-119073963 AGAAATACACAGATGTAGATAGG + Intergenic
1060006800 9:120007804-120007826 AAAAAGGCAAGGAAGGAGAAAGG + Intergenic
1060306886 9:122421727-122421749 AAGATTTCTCAGATGGAGAATGG - Intergenic
1061144795 9:128791361-128791383 GAATCTGCACAGAGGGAGAAGGG - Exonic
1061388062 9:130302033-130302055 AAAAAAGCACAGCTAGAGGATGG - Intronic
1061650442 9:132044099-132044121 AAAAAGTCACAGAGGGACAAAGG + Intronic
1062134941 9:134921333-134921355 AAAAATCCACATCAGGAGAAGGG + Intergenic
1203523109 Un_GL000213v1:62589-62611 AAAAGTGCAAGGATGAAGAAGGG + Intergenic
1186188187 X:7042097-7042119 ATAAATGAAAAGAGGGAGAAGGG - Intergenic
1186400700 X:9256822-9256844 TAAAATGCATAGATGGATGATGG + Intergenic
1186635846 X:11403966-11403988 AAAAAGACACAGATGCAGAAAGG + Intronic
1186853921 X:13607759-13607781 ACAAATGCATAGATAGAAAATGG + Intronic
1187296206 X:18003308-18003330 AAGAATACACAGACGGAAAATGG - Intergenic
1187680512 X:21762555-21762577 AAAAAATAACAGATGAAGAATGG + Intergenic
1187754587 X:22508468-22508490 AAATGTGCACAGAAGTAGAATGG - Intergenic
1188484340 X:30666827-30666849 ATAAATACACAGAAGGAGACTGG + Intronic
1188625069 X:32274028-32274050 AAAAATGCATATTTAGAGAAGGG + Intronic
1189214943 X:39314849-39314871 AGGAGTGGACAGATGGAGAAAGG - Intergenic
1189660726 X:43295382-43295404 ATAGAAGCACAGAAGGAGAATGG + Intergenic
1189835282 X:45014455-45014477 AAAGATGCCCAGAAGGATAAAGG + Intronic
1189868010 X:45351734-45351756 TAAAATGAGCAGATGGAGAGGGG + Intergenic
1190228873 X:48566063-48566085 AAAAACGAAAAGATGAAGAAAGG + Intergenic
1190301708 X:49060839-49060861 CACAATACACAGATGGGGAAGGG + Intronic
1190332583 X:49245007-49245029 AGAAATGGACAGAGGGAGAGGGG - Intronic
1190626518 X:52343106-52343128 AAAAACACACTGATTGAGAAGGG + Intergenic
1190701490 X:52992733-52992755 AAAAACACACTGATTGAGAAGGG - Intronic
1190967676 X:55316919-55316941 AAAATTGTAGAAATGGAGAACGG - Intergenic
1191227272 X:58056393-58056415 AAAAATACACAGAAAGACAAAGG - Intergenic
1191269223 X:58441277-58441299 CAAAATGTACAGTTGCAGAATGG + Intergenic
1191913774 X:66180025-66180047 AAAAATACAAAAATGCAGAATGG - Intronic
1192475688 X:71440138-71440160 AAAACTATAGAGATGGAGAACGG - Intronic
1193165574 X:78276810-78276832 GAAAGTGGACAGATGGAGGATGG + Intronic
1193418960 X:81260315-81260337 ACAAATGCTCAGATGGATTAAGG - Intronic
1194539810 X:95156485-95156507 TAAAATGTTCAGATGGAGACAGG - Intergenic
1194615040 X:96089884-96089906 AAAAATACACATTGGGAGAATGG + Intergenic
1194698742 X:97088338-97088360 AGAAATGAGCAGATGAAGAATGG - Intronic
1194773908 X:97939275-97939297 GAAATTGCACAGATGGAGAGGGG - Intergenic
1194864209 X:99046191-99046213 AAAAATGGACAGATCCAGCAAGG - Intergenic
1195619497 X:106938856-106938878 GAAATTGCAAAGATGGAGATGGG + Intronic
1196093789 X:111776569-111776591 AGATATTCTCAGATGGAGAAAGG - Exonic
1196190311 X:112787893-112787915 AAAAATGGAAGGAAGGAGAAAGG - Intronic
1196260870 X:113579693-113579715 AAACAAGAACAGATTGAGAATGG + Intergenic
1196675564 X:118417121-118417143 AAAGATACAGAGATGCAGAATGG - Intronic
1196695969 X:118612097-118612119 AGAAATGAAGAGAGGGAGAATGG - Intronic
1197105820 X:122714177-122714199 AAAAATGAACACATGGAGAGAGG + Intergenic
1197353783 X:125409205-125409227 AAGAAGGCAGAAATGGAGAAAGG - Intergenic
1197743381 X:129913464-129913486 AAAAATGATCAGATGGGGCACGG - Intronic
1198498073 X:137213849-137213871 AAAAATGCAAAGGTGAGGAATGG + Intergenic
1198897107 X:141467701-141467723 AAAAATGCACAGGTGTGGTATGG + Intergenic
1199123424 X:144085629-144085651 ATAAATGCACAGATGAAAAGAGG + Intergenic
1199179517 X:144836804-144836826 AAAATAACACAGATGGAGGAGGG + Intergenic
1199208138 X:145173671-145173693 AAAAGTCCTCAGATGGAGCAAGG + Intergenic
1199333988 X:146597077-146597099 ATAAATTCAGAGATGGAAAAGGG - Intergenic
1199954123 X:152728758-152728780 AAGAATGGACATATTGAGAAAGG - Intronic
1200037410 X:153341070-153341092 AAAAGTAAACAGATGGAGAATGG - Intronic
1200240898 X:154493022-154493044 AAAATTGGCCAGAGGGAGAAAGG + Intergenic
1201177340 Y:11316837-11316859 AGAATTTCACAGATGGACAAGGG - Intergenic
1201424444 Y:13833032-13833054 AGACATGCACAGATGGACACAGG + Intergenic
1201550574 Y:15212756-15212778 AAAAATGAACAGAAGGTGCAAGG + Intergenic
1201954101 Y:19602112-19602134 AAGAATGCAGTGATGGAGGAAGG + Intergenic
1202363868 Y:24140798-24140820 AAAAGTGCACACAGGGAGAAGGG + Intergenic
1202506912 Y:25529324-25529346 AAAAGTGCACACAGGGAGAAGGG - Intergenic