ID: 1108672817

View in Genome Browser
Species Human (GRCh38)
Location 13:52709059-52709081
Sequence CAGGTGAGACATATCTGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 116}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108672812_1108672817 4 Left 1108672812 13:52709032-52709054 CCAGCTTCCTTTGCAATTAGAAG 0: 1
1: 0
2: 7
3: 57
4: 336
Right 1108672817 13:52709059-52709081 CAGGTGAGACATATCTGACCAGG 0: 1
1: 0
2: 2
3: 6
4: 116
1108672809_1108672817 16 Left 1108672809 13:52709020-52709042 CCATTCATTTCCCCAGCTTCCTT 0: 1
1: 0
2: 6
3: 54
4: 727
Right 1108672817 13:52709059-52709081 CAGGTGAGACATATCTGACCAGG 0: 1
1: 0
2: 2
3: 6
4: 116
1108672811_1108672817 5 Left 1108672811 13:52709031-52709053 CCCAGCTTCCTTTGCAATTAGAA 0: 1
1: 1
2: 8
3: 74
4: 423
Right 1108672817 13:52709059-52709081 CAGGTGAGACATATCTGACCAGG 0: 1
1: 0
2: 2
3: 6
4: 116
1108672810_1108672817 6 Left 1108672810 13:52709030-52709052 CCCCAGCTTCCTTTGCAATTAGA 0: 1
1: 0
2: 4
3: 58
4: 354
Right 1108672817 13:52709059-52709081 CAGGTGAGACATATCTGACCAGG 0: 1
1: 0
2: 2
3: 6
4: 116
1108672814_1108672817 -3 Left 1108672814 13:52709039-52709061 CCTTTGCAATTAGAAGTGGCCAG 0: 1
1: 0
2: 11
3: 51
4: 259
Right 1108672817 13:52709059-52709081 CAGGTGAGACATATCTGACCAGG 0: 1
1: 0
2: 2
3: 6
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108672817 Original CRISPR CAGGTGAGACATATCTGACC AGG Intronic
906867126 1:49434053-49434075 CATGAGAGACATCTCTGCCCTGG + Intronic
911593273 1:99772032-99772054 CAAGTGAGATATTTCTGGCCTGG + Intergenic
915089816 1:153416555-153416577 CAGGTGAGACTTACCAGAACTGG - Exonic
915093081 1:153439920-153439942 CAGGTGAGACTTACCAGAGCTGG + Exonic
915095693 1:153460594-153460616 CAGGTGAGACTTACCAGAGCTGG + Exonic
920998200 1:211015249-211015271 CAGTTGAGTCAAAACTGACCAGG - Intronic
921455133 1:215362063-215362085 CTTTTGAGACATATCTGTCCAGG + Intergenic
922688364 1:227665872-227665894 AAGGTGAGGCAAACCTGACCAGG - Intronic
1064403955 10:15044032-15044054 CATATGAGACATATCTGAGAAGG - Intronic
1067508467 10:46876155-46876177 CAGGTGAGAAAAGTATGACCTGG - Intergenic
1067653782 10:48175694-48175716 CAGGTGAGAAAAGTATGACCTGG + Intronic
1069321645 10:67178977-67178999 CAGGTGAGAGATTTCTGGTCAGG + Intronic
1070036292 10:72728483-72728505 AAGCTGAGACATATATGACAAGG + Intronic
1071841911 10:89480255-89480277 GAGGTCAGACATATCTGGCTTGG + Intronic
1073164592 10:101434179-101434201 TATGTGAGTAATATCTGACCTGG + Intronic
1075664629 10:124221712-124221734 GAGATGAGTCATTTCTGACCAGG + Intergenic
1076876587 10:133219268-133219290 CAGGTGGGACACCTCTGCCCAGG - Intronic
1078752649 11:14179560-14179582 TGGATGAGACATATCTGACTGGG + Intronic
1079968694 11:27009285-27009307 CATATAAGACATATCTGACAGGG - Intergenic
1081579060 11:44339531-44339553 CTGGAGAGACAGATCTGGCCTGG + Intergenic
1091041722 11:132287133-132287155 CTGGTTAGACAGATCTGACAAGG - Intronic
1091750207 12:3017609-3017631 CAGGTGAGAGAAATCTGGGCTGG - Intronic
1092310100 12:7343146-7343168 GAGGAGAGAAATATCTGAACTGG + Intergenic
1096393488 12:51247942-51247964 CAAGGGAGGAATATCTGACCTGG + Intronic
1099925595 12:89012579-89012601 CCAGTGAGACATTTCTCACCTGG + Intergenic
1103343163 12:120231922-120231944 CAGGTGAGACAAGGCTGCCCAGG + Intronic
1103453618 12:121047644-121047666 CAGGTGAGCCAGATCAGACCAGG + Intergenic
1103704164 12:122862404-122862426 GAGGTGAGACATAGCGGCCCGGG + Exonic
1106292921 13:28382024-28382046 GAGGGGAGACATATATGAACTGG + Intronic
1106402145 13:29441297-29441319 CATGGGAGCCATATGTGACCTGG + Intronic
1108672817 13:52709059-52709081 CAGGTGAGACATATCTGACCAGG + Intronic
1109364988 13:61342646-61342668 TAGGTGAGACCTGGCTGACCAGG - Intergenic
1113066362 13:106377094-106377116 CAGGGGAGACACATGTGACACGG - Intergenic
1114470595 14:22958294-22958316 CAGGTGAAAGATATTTGGCCGGG - Intronic
1121787084 14:96670228-96670250 CTGGGGAGACAGACCTGACCCGG + Intergenic
1125810908 15:42540284-42540306 CAGGTCAGAAATATTTGAGCGGG + Exonic
1126499321 15:49327208-49327230 CAGATGAGATATATCTGATTGGG - Intronic
1126651142 15:50922386-50922408 GAGTTGAAACAAATCTGACCCGG - Intronic
1132415111 15:101613930-101613952 CAGGTGAGGCATGTGGGACCAGG - Intergenic
1135204888 16:20475324-20475346 CAGGTGAGACATTGGTCACCAGG - Intronic
1135214004 16:20548489-20548511 CAGGTGAGACATTGGTCACCAGG + Intronic
1137518677 16:49173099-49173121 AAGGTGAGACCAACCTGACCTGG - Intergenic
1138705785 16:58913566-58913588 CTGGTGTGACATATCTGGTCTGG + Intergenic
1140054931 16:71517161-71517183 CAGGAAAGGCATATCTGAACAGG + Intronic
1140310219 16:73841393-73841415 CAGGGGAGACATGGCGGACCAGG + Intergenic
1140524028 16:75607224-75607246 CAGGTGAGAGCCATCTCACCCGG - Intronic
1142069696 16:88084524-88084546 CAGATGAGACACATCTGAGGAGG + Intronic
1142895582 17:2975698-2975720 CAGGTGAGACTTAACTGCACAGG - Intronic
1143754320 17:9055473-9055495 CAGGTGAGGCCTATCTGAGGAGG + Intronic
1147945133 17:44076494-44076516 CAGGTGAGACCTCTCAGCCCTGG + Intergenic
1148510672 17:48166811-48166833 CATGTTAGACCTTTCTGACCTGG - Intronic
1151304272 17:73253058-73253080 CAGCTGAGAAAAAGCTGACCTGG + Intronic
1151474442 17:74337842-74337864 CAGGTGAGCCAGAGCTGAGCTGG - Intronic
1154955400 18:21249557-21249579 AAAGTGAGAGATATCTGGCCGGG + Intronic
1156348017 18:36275398-36275420 CAGTTGAGACACATCTGAAGAGG + Intergenic
1157413363 18:47482157-47482179 CAGGTGTGCCAGGTCTGACCTGG - Intergenic
1160596027 18:79974981-79975003 CAGGAGAGGCAAATCTGATCAGG + Intronic
925615806 2:5743585-5743607 CAGGTGAGACAGGTGTGTCCTGG + Intergenic
929029315 2:37635999-37636021 CATGTGAGACATGACTGCCCTGG - Intergenic
929152908 2:38763471-38763493 CAGATGAGAAATATCTGAAGTGG - Intronic
929293504 2:40220308-40220330 CAGCTGAGACATCTCTGACTTGG + Intronic
935822127 2:106905099-106905121 AATGTGAGAAATATCTGACAAGG - Intergenic
940025361 2:149200945-149200967 TAGGTGAGGGATTTCTGACCAGG + Intronic
941524623 2:166591897-166591919 CATATTAGACATATCTGACAAGG - Intergenic
942252845 2:174062384-174062406 CAGGTGAGCCAGCTCTGGCCTGG - Intergenic
942586800 2:177488978-177489000 CAGATGAGACATATTTGAGAAGG - Intronic
945761731 2:213923154-213923176 CAGGTGAGCCACATCTGATAGGG - Intronic
946718127 2:222575074-222575096 CAAGGGAGATATAGCTGACCTGG + Intronic
946905628 2:224413429-224413451 CAGGTGTGACCTACCTCACCTGG + Intergenic
1175170925 20:57081053-57081075 CAGGTGACTCATATCTGACCTGG - Intergenic
1184813639 22:46854192-46854214 CACGTGACACATTTCTGACAGGG - Intronic
949578716 3:5364693-5364715 CAGGCAAAACAAATCTGACCAGG - Intergenic
950566739 3:13773755-13773777 TAGATGGGACATATCTGAGCAGG + Intergenic
950615132 3:14152203-14152225 AAAGTGAGACATTTCTGATCAGG + Intronic
950964435 3:17136534-17136556 CAGATGGGACTTTTCTGACCAGG + Intergenic
951119267 3:18905548-18905570 CAGGTGTGAAGTATTTGACCTGG + Intergenic
952840986 3:37645186-37645208 CAGGAGTGACATTTCTGAACTGG - Intronic
955856489 3:63278549-63278571 CAGGTGAGACAGAACTGGGCAGG + Exonic
957707880 3:83813533-83813555 CAGGAGACACATACCTGTCCAGG - Intergenic
960002921 3:112751770-112751792 CAAGTGAAACTTATCTGACCTGG - Intronic
960336397 3:116422826-116422848 CAGGTAAGACATTTCTGAAGGGG - Intronic
966350691 3:179030860-179030882 CAGGTGAGACATGTGTGTCAGGG - Exonic
970210223 4:13702132-13702154 AAGGTGAGTCATTTCTGGCCTGG + Intergenic
979713075 4:123803514-123803536 CAGCTGACACATATCTGAGGTGG + Intergenic
979743031 4:124175209-124175231 CAGGTCACACATATGTTACCTGG - Intergenic
982344083 4:154337105-154337127 CAGATGAGAAAGATCTGACTTGG - Intronic
983554833 4:169050823-169050845 CATTTGAGAAATATCTGACTAGG + Intergenic
984913348 4:184697157-184697179 CAGGTGAGAGCTATCACACCCGG + Intronic
986130091 5:4922070-4922092 CAGGAGAGAAATATCTGATCAGG - Intergenic
986371343 5:7083306-7083328 CAGGAGTGACATTTCTGTCCAGG + Intergenic
994816143 5:104591051-104591073 CAGGGGAGGCAAATCTTACCAGG - Intergenic
997255888 5:132427694-132427716 CAGGTGAGAGATTCCAGACCTGG + Intronic
1000433880 5:161184428-161184450 CCGGTGAGACAAATCTGGCCTGG + Intergenic
1004373229 6:15070654-15070676 AATGTGAGACATATCAGTCCAGG + Intergenic
1005155963 6:22806732-22806754 CATCTGAGACATCTGTGACCCGG + Intergenic
1007558590 6:42786774-42786796 CTGGGGAGACATTTCAGACCTGG + Intronic
1012636785 6:101552689-101552711 CAGGTTAGACACATCTGTCTGGG - Intronic
1013460701 6:110372486-110372508 CATATGAAAGATATCTGACCAGG - Intergenic
1013569990 6:111412978-111413000 CAGGTGAGACTTTTCTGAGAAGG - Intronic
1014371031 6:120607721-120607743 TAGGTGAGGCAGATTTGACCAGG - Intergenic
1015185322 6:130408998-130409020 CATGTGAGACAGAGCTGGCCTGG - Intronic
1015360533 6:132334104-132334126 TATGTGAGGCATATTTGACCTGG - Intronic
1016948033 6:149552036-149552058 AAGGTGAGACCTATCTCAACTGG + Intergenic
1017001699 6:150001891-150001913 CAGGTGAGACATGTCTGGAGGGG - Intergenic
1019848689 7:3532437-3532459 CAGGTGAGACCTAACGTACCAGG - Intronic
1021729160 7:23579609-23579631 CAGGTGTGACCTATCTTGCCTGG + Intergenic
1023946236 7:44805235-44805257 CATTTGAGACCTTTCTGACCAGG - Intronic
1031483669 7:122305242-122305264 GAGGTGGCACAGATCTGACCCGG - Intronic
1031606526 7:123774708-123774730 CAGGTGAGATCTATGTGAGCCGG - Intergenic
1035962378 8:4151582-4151604 CATGAGAAACATATCTGACAAGG - Intronic
1037250503 8:16887661-16887683 CAGTTGAGACCCATTTGACCTGG - Intergenic
1046575821 8:116027506-116027528 CAGGTGAAACATCTTTGAGCTGG + Intergenic
1047399085 8:124530952-124530974 CAGATGAGACATGTGCGACCAGG + Intronic
1049285688 8:141773964-141773986 CTGGGAAGCCATATCTGACCTGG + Intergenic
1049800215 8:144514169-144514191 AAGGTGAGCCATATGTGAACTGG - Exonic
1050668488 9:7968580-7968602 AAGCTGAGACAAATCTGAACTGG + Intergenic
1051868683 9:21711630-21711652 CAGGAGAGACAAACCTGACGTGG + Intergenic
1052660959 9:31431271-31431293 CAGGTGTGAGACATCTCACCTGG + Intergenic
1058545055 9:106052438-106052460 CAGAAGAGACATTTCTCACCAGG + Intergenic
1058679331 9:107427543-107427565 GAATTGAGACATATCTGGCCTGG + Intergenic
1059324388 9:113495277-113495299 CTGCTGAGACCAATCTGACCTGG - Intronic
1060193364 9:121607125-121607147 CAGGACAGAGATCTCTGACCTGG - Intronic
1196109763 X:111933414-111933436 CAGATGAGACATATCTGCCCAGG + Intronic
1199160328 X:144602050-144602072 CAGATGAAAAATATCTGACCAGG + Intergenic
1200142491 X:153909029-153909051 CAGGTGAGGGACATCTGTCCTGG - Intronic