ID: 1108676022

View in Genome Browser
Species Human (GRCh38)
Location 13:52738931-52738953
Sequence GAGGGGCGCGCGGCTGCCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 418
Summary {0: 1, 1: 1, 2: 3, 3: 55, 4: 358}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108676022_1108676033 5 Left 1108676022 13:52738931-52738953 CCGCCGGCAGCCGCGCGCCCCTC 0: 1
1: 1
2: 3
3: 55
4: 358
Right 1108676033 13:52738959-52738981 CCCGCGCTCGGGCTCCCCCTAGG 0: 1
1: 0
2: 1
3: 15
4: 143
1108676022_1108676028 -6 Left 1108676022 13:52738931-52738953 CCGCCGGCAGCCGCGCGCCCCTC 0: 1
1: 1
2: 3
3: 55
4: 358
Right 1108676028 13:52738948-52738970 CCCCTCGCCGGCCCGCGCTCGGG 0: 1
1: 0
2: 1
3: 20
4: 235
1108676022_1108676036 7 Left 1108676022 13:52738931-52738953 CCGCCGGCAGCCGCGCGCCCCTC 0: 1
1: 1
2: 3
3: 55
4: 358
Right 1108676036 13:52738961-52738983 CGCGCTCGGGCTCCCCCTAGGGG 0: 1
1: 0
2: 0
3: 9
4: 80
1108676022_1108676037 15 Left 1108676022 13:52738931-52738953 CCGCCGGCAGCCGCGCGCCCCTC 0: 1
1: 1
2: 3
3: 55
4: 358
Right 1108676037 13:52738969-52738991 GGCTCCCCCTAGGGGCACCATGG 0: 1
1: 0
2: 0
3: 11
4: 138
1108676022_1108676045 26 Left 1108676022 13:52738931-52738953 CCGCCGGCAGCCGCGCGCCCCTC 0: 1
1: 1
2: 3
3: 55
4: 358
Right 1108676045 13:52738980-52739002 GGGGCACCATGGGCGACACGGGG 0: 1
1: 0
2: 0
3: 3
4: 85
1108676022_1108676035 6 Left 1108676022 13:52738931-52738953 CCGCCGGCAGCCGCGCGCCCCTC 0: 1
1: 1
2: 3
3: 55
4: 358
Right 1108676035 13:52738960-52738982 CCGCGCTCGGGCTCCCCCTAGGG 0: 1
1: 0
2: 1
3: 4
4: 50
1108676022_1108676044 25 Left 1108676022 13:52738931-52738953 CCGCCGGCAGCCGCGCGCCCCTC 0: 1
1: 1
2: 3
3: 55
4: 358
Right 1108676044 13:52738979-52739001 AGGGGCACCATGGGCGACACGGG 0: 1
1: 0
2: 0
3: 10
4: 119
1108676022_1108676038 16 Left 1108676022 13:52738931-52738953 CCGCCGGCAGCCGCGCGCCCCTC 0: 1
1: 1
2: 3
3: 55
4: 358
Right 1108676038 13:52738970-52738992 GCTCCCCCTAGGGGCACCATGGG 0: 1
1: 0
2: 0
3: 7
4: 80
1108676022_1108676046 27 Left 1108676022 13:52738931-52738953 CCGCCGGCAGCCGCGCGCCCCTC 0: 1
1: 1
2: 3
3: 55
4: 358
Right 1108676046 13:52738981-52739003 GGGCACCATGGGCGACACGGGGG 0: 1
1: 1
2: 0
3: 5
4: 87
1108676022_1108676043 24 Left 1108676022 13:52738931-52738953 CCGCCGGCAGCCGCGCGCCCCTC 0: 1
1: 1
2: 3
3: 55
4: 358
Right 1108676043 13:52738978-52739000 TAGGGGCACCATGGGCGACACGG 0: 1
1: 0
2: 0
3: 7
4: 137
1108676022_1108676026 -7 Left 1108676022 13:52738931-52738953 CCGCCGGCAGCCGCGCGCCCCTC 0: 1
1: 1
2: 3
3: 55
4: 358
Right 1108676026 13:52738947-52738969 GCCCCTCGCCGGCCCGCGCTCGG 0: 1
1: 0
2: 1
3: 21
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108676022 Original CRISPR GAGGGGCGCGCGGCTGCCGG CGG (reversed) Intronic