ID: 1108676078

View in Genome Browser
Species Human (GRCh38)
Location 13:52739121-52739143
Sequence CTTGAGCAGCCGCGCGGGGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 268}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108676071_1108676078 -10 Left 1108676071 13:52739108-52739130 CCACGGCTCCCACCTTGAGCAGC 0: 1
1: 0
2: 6
3: 25
4: 197
Right 1108676078 13:52739121-52739143 CTTGAGCAGCCGCGCGGGGCTGG 0: 1
1: 0
2: 1
3: 21
4: 268
1108676064_1108676078 26 Left 1108676064 13:52739072-52739094 CCCCAAAGAGCAGCAGCACAGCT 0: 1
1: 0
2: 1
3: 23
4: 285
Right 1108676078 13:52739121-52739143 CTTGAGCAGCCGCGCGGGGCTGG 0: 1
1: 0
2: 1
3: 21
4: 268
1108676066_1108676078 24 Left 1108676066 13:52739074-52739096 CCAAAGAGCAGCAGCACAGCTCC 0: 1
1: 0
2: 4
3: 26
4: 221
Right 1108676078 13:52739121-52739143 CTTGAGCAGCCGCGCGGGGCTGG 0: 1
1: 0
2: 1
3: 21
4: 268
1108676070_1108676078 2 Left 1108676070 13:52739096-52739118 CCGAAATGAGGACCACGGCTCCC 0: 1
1: 0
2: 1
3: 7
4: 70
Right 1108676078 13:52739121-52739143 CTTGAGCAGCCGCGCGGGGCTGG 0: 1
1: 0
2: 1
3: 21
4: 268
1108676065_1108676078 25 Left 1108676065 13:52739073-52739095 CCCAAAGAGCAGCAGCACAGCTC 0: 1
1: 0
2: 3
3: 16
4: 214
Right 1108676078 13:52739121-52739143 CTTGAGCAGCCGCGCGGGGCTGG 0: 1
1: 0
2: 1
3: 21
4: 268
1108676069_1108676078 3 Left 1108676069 13:52739095-52739117 CCCGAAATGAGGACCACGGCTCC 0: 1
1: 0
2: 0
3: 8
4: 79
Right 1108676078 13:52739121-52739143 CTTGAGCAGCCGCGCGGGGCTGG 0: 1
1: 0
2: 1
3: 21
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108676078 Original CRISPR CTTGAGCAGCCGCGCGGGGC TGG Exonic
900099766 1:956807-956829 GGTGAGCAGCAGCGAGGGGCGGG - Intronic
900758876 1:4457007-4457029 CTTGAGCCACCGCGCCTGGCCGG + Intergenic
900773553 1:4564413-4564435 CTTGGGCAGCTGCGGTGGGCAGG - Intergenic
901853485 1:12030124-12030146 GGTGAGCAGCCACGTGGGGCTGG + Exonic
901885060 1:12216939-12216961 CTTGAGCCACCGCGCCAGGCTGG - Intergenic
903552535 1:24167976-24167998 CTTGAGCCACCGCGCCCGGCTGG + Intronic
903934501 1:26885858-26885880 CTTGAGCAACCGCGCCCAGCCGG + Intronic
904667240 1:32132620-32132642 CTTGAGCCACCACGCTGGGCTGG - Intronic
905136690 1:35805951-35805973 CTTGAGCCACCGCGCCCGGCCGG - Intergenic
905185435 1:36192843-36192865 CTTGAGCCACCGCGCCCGGCTGG + Intergenic
905451586 1:38060389-38060411 CCTGGGCAGCCCCGGGGGGCAGG - Intergenic
907042701 1:51277694-51277716 CGTGAGCAACCGCGCCCGGCCGG + Intergenic
908833437 1:68204586-68204608 CTTGAGCCACCGCGCCCGGCCGG + Intronic
909252058 1:73371031-73371053 CTTGAGCCACCGCGCCCGGCCGG - Intergenic
909933806 1:81528363-81528385 CGTGAGCCACCGCGCCGGGCCGG - Intronic
910531284 1:88238128-88238150 CGTGAGCCACCGCGCTGGGCTGG + Intergenic
911715369 1:101126707-101126729 CGTGAGCCACCGCGCTGGGCCGG - Intergenic
912350058 1:109003981-109004003 CTTGAGCCACCGCGCCCGGCCGG - Intronic
912685182 1:111756294-111756316 CCTGAGCTGCGGCGCGGGCCTGG - Intronic
913109255 1:115642506-115642528 CTGCAGCAGCCGTGCAGGGCGGG + Intronic
916067596 1:161148934-161148956 CTTGAGCCACCGCACCGGGCCGG - Intergenic
916104437 1:161420718-161420740 CGTGAGCCGCCGCGCCTGGCCGG + Intergenic
918275859 1:182953221-182953243 CTCGAGCAGCCGCTCGTTGCGGG - Exonic
919881268 1:201902724-201902746 CGTGAGCCGCCGCGCCAGGCTGG + Intronic
920579302 1:207089988-207090010 CTTGAGCCGCTGCGCCCGGCCGG - Intronic
920674447 1:208029509-208029531 CTTGGGCAGCCGGGCTGGGCGGG - Intronic
921065863 1:211621499-211621521 CTTGTGCAGCAGGGCTGGGCTGG - Intergenic
922452540 1:225748505-225748527 CATGAGCCACCGCGCCGGGCTGG + Intergenic
922783241 1:228269751-228269773 GTTGAGGGGCCGCGCGAGGCAGG + Intronic
922851835 1:228739282-228739304 CGTGAGCAACCGCGCCTGGCTGG - Intronic
923332553 1:232939219-232939241 CTTGAGCCACCGCGCCCGGCAGG - Intergenic
923352004 1:233117348-233117370 CGTGAGCAACCGCGCCAGGCCGG - Intronic
924084579 1:240437581-240437603 CGTGAGCCACCGCGCCGGGCTGG + Intronic
924527092 1:244863112-244863134 CGGGAGGAGCCGGGCGGGGCGGG - Intronic
1064410305 10:15098604-15098626 CGTGAGCCACCGCGCCGGGCCGG - Intronic
1067045025 10:42980670-42980692 CTTGAGGAGCCATGGGGGGCAGG + Intergenic
1068955637 10:62817190-62817212 CTTCAGCTGCTGCGCGGAGCGGG + Intronic
1071618408 10:87095782-87095804 CGTGAGCCACCGCGCCGGGCCGG - Intronic
1072915012 10:99532585-99532607 TTTCAGCTGCTGCGCGGGGCAGG - Intergenic
1073185030 10:101610830-101610852 CTTGACCAACCTCTCGGGGCTGG - Exonic
1073296409 10:102441960-102441982 TTTGAGCCACCGCGCTGGGCTGG + Intergenic
1073479795 10:103779321-103779343 CATGAGGCGCCGTGCGGGGCCGG + Intronic
1075422008 10:122308780-122308802 CTGGAGCAGCTGAGCTGGGCAGG - Intronic
1076770165 10:132658635-132658657 CATGAGCACCCCCGGGGGGCCGG - Intronic
1076872647 10:133201299-133201321 CCTGAACTGCCGCACGGGGCCGG - Intronic
1077247303 11:1546011-1546033 CATGAGCCACCGCGCAGGGCTGG + Intergenic
1077296969 11:1830935-1830957 CCTGACCAGCCCCGTGGGGCCGG + Intronic
1077349851 11:2087641-2087663 CATGAGCCGCCGCGCCTGGCCGG - Intergenic
1077754356 11:5009825-5009847 CTTGAGCCACCGCGCCCGGCCGG + Intergenic
1077755573 11:5024677-5024699 TTTGAGCAGCTGCGCTGTGCTGG - Intergenic
1078635809 11:13048804-13048826 CGTGAGCCACCGCGCCGGGCCGG + Intergenic
1079128439 11:17734597-17734619 CAGCAGGAGCCGCGCGGGGCGGG + Intergenic
1080390489 11:31841596-31841618 ATGGAGCAGCCAAGCGGGGCTGG + Intronic
1082030937 11:47602933-47602955 CTTGAGCCACCGCGCCTGGCCGG + Intergenic
1083221746 11:61257274-61257296 CCTGAGCCACCGCGCCGGGCCGG - Intergenic
1083388888 11:62333723-62333745 CTTGAGCCACCGCGCGCGGCTGG + Intergenic
1083403885 11:62443551-62443573 CTTGAGCCACCGCGCCCGGCTGG + Intronic
1084168448 11:67388401-67388423 CATGAGCCGCCGCGCCCGGCTGG + Intronic
1084673969 11:70623652-70623674 CTTAAGCAGCCGCGGGTGGCTGG - Intronic
1085287151 11:75370553-75370575 CGTGAGCCACCGCGCCGGGCGGG + Intergenic
1087109767 11:94451922-94451944 CATGAGCAACCGCGCCTGGCCGG - Intronic
1090015495 11:123082580-123082602 CATGAGCCGCCACGCTGGGCTGG + Intronic
1090636361 11:128692848-128692870 TTGGAGCAGCCTCGAGGGGCTGG - Intronic
1091527342 12:1316166-1316188 CTTGAGCCACCGCGCCCGGCTGG + Intronic
1092250256 12:6891146-6891168 CCTGGGCGGCTGCGCGGGGCGGG - Intronic
1096144172 12:49266142-49266164 CGTGAGCCACCGCGCCGGGCCGG - Intronic
1098552697 12:71781186-71781208 CTTGAGCCACCGCGCCCGGCCGG - Intronic
1098661723 12:73102710-73102732 CTTGAGCCACCGCGCCTGGCAGG - Intergenic
1099912905 12:88854969-88854991 CGTGAGCCGCCGCGCCCGGCCGG + Intergenic
1100565446 12:95790323-95790345 CGGGAGCAGCCGGGCCGGGCGGG + Exonic
1102256221 12:111416773-111416795 CATGAGCCACCGCGCGTGGCTGG + Intronic
1102300354 12:111766886-111766908 CATTGGCTGCCGCGCGGGGCGGG + Intronic
1102705025 12:114873834-114873856 GTTCAGCAGCCCCGCGTGGCCGG + Intergenic
1103474999 12:121211468-121211490 CGTGAGCCCCCACGCGGGGCTGG + Intronic
1103501518 12:121406566-121406588 CGTGAGCCACCGCGCCGGGCTGG + Intronic
1103583878 12:121936795-121936817 CTTGTCCAGCCGTGCTGGGCAGG + Intronic
1105253820 13:18726317-18726339 CGTGAGCCGCCGCGCCCGGCCGG + Intergenic
1106250397 13:27978089-27978111 CTGTAGCTGCCGCGCGGGCCAGG - Exonic
1108404337 13:50084359-50084381 CGTGAGCCACCGCGCTGGGCGGG + Intronic
1108676078 13:52739121-52739143 CTTGAGCAGCCGCGCGGGGCTGG + Exonic
1108814922 13:54278596-54278618 CTTGAGCCACCGCGCCTGGCCGG + Intergenic
1111964993 13:94851742-94851764 ATTGAGAAGCCACTCGGGGCTGG + Intergenic
1112051028 13:95644105-95644127 CTTGAGGCGCCGCGCAAGGCTGG - Intronic
1113568984 13:111339746-111339768 CATGGGCAGCCGCGCCGGGAGGG + Intronic
1114328880 14:21616503-21616525 CTTGAGCCACCGCGCCTGGCTGG - Intergenic
1118841774 14:69518867-69518889 CTTGAGCAGCCCAGAGTGGCTGG + Intronic
1119227752 14:72956929-72956951 CGTGAGCCACCGCGCCGGGCCGG - Intronic
1119666941 14:76491594-76491616 CTCCAGCAGCCCCGCGAGGCGGG - Exonic
1126049155 15:44671206-44671228 CATGAGCAACCGCGCCCGGCTGG - Intronic
1127760605 15:62135868-62135890 CTTGATCAGCAGGGCAGGGCGGG + Intergenic
1128322523 15:66703372-66703394 CTTGGGCAGCCGAGCTGAGCCGG + Exonic
1128423959 15:67521143-67521165 CTCGGGCACCCGCGCGGCGCCGG + Exonic
1129203045 15:74017076-74017098 CATGAGCCGCCGCGCCCGGCCGG + Intronic
1131263558 15:90902760-90902782 CTGGCGGACCCGCGCGGGGCCGG + Intronic
1132523315 16:401483-401505 TTTGGGAAGCGGCGCGGGGCTGG + Intronic
1132584712 16:701092-701114 CGTGAGCTCCCGAGCGGGGCGGG - Intronic
1132789583 16:1678249-1678271 CTTGAGTACCTGCGCTGGGCGGG + Exonic
1136365034 16:29806043-29806065 CGGGAGGAGGCGCGCGGGGCGGG - Intergenic
1136412717 16:30086355-30086377 CTGGAGCTGCCGCACGGGTCAGG - Exonic
1141841332 16:86576089-86576111 CTTCTGCAAACGCGCGGGGCTGG + Intergenic
1141878788 16:86844604-86844626 CTTGAGCCACCGCGCCCGGCTGG + Intergenic
1142001744 16:87668210-87668232 ATCCAGCAGCCGCGCAGGGCTGG - Intronic
1142378684 16:89720215-89720237 CTTGGGCAGCCGGGTGTGGCTGG + Intronic
1142580402 17:938398-938420 CGTGAGCCGCCGCGCCCGGCCGG - Intronic
1144211317 17:13017846-13017868 CTTGCGCGGCCGCTCGCGGCGGG + Exonic
1144611818 17:16726095-16726117 CTTGAGCCACCGCGCCCGGCCGG - Intronic
1144772587 17:17768241-17768263 CTTGTGCAGCTGCCCAGGGCTGG + Intronic
1144900920 17:18589291-18589313 CTTGAGCCACCGCGCCCGGCCGG + Intergenic
1145291911 17:21553637-21553659 CTTGAGCCACCGCGCCCGGCTGG - Intronic
1145955328 17:28850577-28850599 CTTGAGCCACCGCGCCCGGCCGG + Intronic
1146699562 17:34944643-34944665 CGTGAGCCGCCGCGCCTGGCTGG - Intronic
1147953602 17:44120457-44120479 CGTGAGCCGCCGCGCCTGGCCGG - Intronic
1148662215 17:49343915-49343937 CTTGAGCCACCGCGCCTGGCCGG - Intronic
1148842559 17:50508369-50508391 CGTCACCAGCCGGGCGGGGCGGG - Exonic
1151727861 17:75894951-75894973 CTCCAGCAGCTGCCCGGGGCGGG + Intronic
1152197304 17:78925224-78925246 TTTGCGCGGCCGAGCGGGGCAGG - Exonic
1152433031 17:80260314-80260336 CCCGAGCAGCCGAGTGGGGCGGG - Intergenic
1152728948 17:81960652-81960674 GTTGAGCTGCTGCGCGGAGCAGG + Exonic
1152805455 17:82353752-82353774 TTTGAACACCCGCGAGGGGCGGG - Intergenic
1152875224 17:82782625-82782647 CTTGAGCCGCCGCGCCTGGAAGG + Intronic
1153297951 18:3565552-3565574 CGTGAGCCACCGCGCTGGGCCGG - Intronic
1153565679 18:6414968-6414990 CGGGAGCATGCGCGCGGGGCGGG - Intronic
1153878936 18:9403918-9403940 CTGGAGCAGCCCCATGGGGCCGG - Intergenic
1154382984 18:13869217-13869239 CTAGAGCAGCCCTGCGTGGCGGG - Intergenic
1156286962 18:35706227-35706249 CTTGAGCCACCGCGCCCGGCCGG - Intronic
1156330462 18:36116955-36116977 CGTGAGCCGCCGCGCCTGGCCGG - Intronic
1156513523 18:37661149-37661171 CCTGGGCAGCCGGGTGGGGCTGG + Intergenic
1156788123 18:40939835-40939857 CTGCGGCAGCCGCGCAGGGCTGG - Intergenic
1157794111 18:50559637-50559659 CGGCTGCAGCCGCGCGGGGCTGG + Intergenic
1159038112 18:63296929-63296951 CGTGAGCCACCGTGCGGGGCCGG - Intronic
1160668437 19:344514-344536 CATGCGCGGCGGCGCGGGGCGGG - Intronic
1160776818 19:860446-860468 TTTGTGAAGCCGCGCGGGGGCGG - Intronic
1160901097 19:1429126-1429148 CTTGAGCCCCCGCGAGGTGCCGG + Intronic
1161156259 19:2733180-2733202 GCTGAGCAGGCGCACGGGGCTGG + Exonic
1161159059 19:2751653-2751675 CGTGAGCCACCGCGCCGGGCCGG - Intergenic
1161345005 19:3764362-3764384 CGTGAGCCGCCGCGCCCGGCCGG + Intronic
1161589874 19:5124490-5124512 CTTGAGCAGACTCTAGGGGCTGG + Intronic
1161723945 19:5917902-5917924 CCTGCGCAGCCGCGTGGAGCAGG - Exonic
1161800807 19:6415920-6415942 CTTGAGCAGTGGTGCGGGGGTGG + Intronic
1162339949 19:10086329-10086351 GTCCAGCAGCCGCGCAGGGCAGG - Exonic
1162645976 19:12050811-12050833 CGTGAGCCACCGCGCGCGGCCGG - Intronic
1162893904 19:13753204-13753226 CTTGTGCAGCCTCAGGGGGCAGG - Intronic
1163312496 19:16522628-16522650 CTGGAGAAGCCGGGCAGGGCTGG - Intronic
1163368587 19:16889593-16889615 CCTGGGTAGCCGCGGGGGGCAGG - Exonic
1165349353 19:35267981-35268003 TTTGTTCGGCCGCGCGGGGCGGG + Intergenic
1165573835 19:36797305-36797327 CGTGAGCCGCCGCGCTCGGCCGG + Intergenic
1165775749 19:38403438-38403460 CTCGAGCAGCAGCGAGAGGCGGG + Exonic
1167338094 19:48898833-48898855 CGTGAGCCACCGCGCCGGGCCGG - Intergenic
1167442849 19:49519121-49519143 CTTGAGCCACCGCGCCCGGCCGG + Intronic
1167962201 19:53115052-53115074 CTTGAGCTGCCGCGCCCGGCCGG - Intronic
1168122316 19:54258559-54258581 CGTGAGCCACCGCGCCGGGCCGG - Intronic
925610386 2:5696816-5696838 CCTGAGCCGGCGCGCGGGGAGGG - Exonic
926018450 2:9474546-9474568 ATGGAGCAGCCGGGCGGGGCGGG - Exonic
926202552 2:10812444-10812466 CTTCCGCAGCCGCGGGGGGCGGG - Intronic
929780065 2:44951899-44951921 CGTGAGCAGCCTGGCGGGGCTGG - Intergenic
932495322 2:72143263-72143285 CTAGCGCAGCCGGGAGGGGCGGG + Intronic
932575540 2:72960529-72960551 CCTGTGCTGCCGCGTGGGGCTGG - Intronic
932591656 2:73071272-73071294 CCTGAGCAGCCGCTCGAAGCCGG + Intronic
934988618 2:98904967-98904989 CTTGAGCCACCGCGCCCGGCCGG - Intronic
935196682 2:100820381-100820403 CCGGAGCGGCCCCGCGGGGCCGG - Exonic
935371829 2:102355800-102355822 CCTGCCCAGCCGCGCGGCGCGGG - Intronic
936104564 2:109613866-109613888 CGGGACCAGCCGCTCGGGGCCGG - Exonic
948277440 2:236719857-236719879 CTTGAGCAGCAGCACCAGGCAGG + Intergenic
948749615 2:240124216-240124238 CCTGAGCATCAGCGAGGGGCTGG - Intergenic
948929506 2:241122981-241123003 CTTCAGCAGCCGCCCGAGGCAGG + Intronic
1172640283 20:36436533-36436555 CGTGAGCCACCGCGCCGGGCGGG - Intronic
1173322382 20:41999400-41999422 CTGGAGCAGGTGCGCGGGGCCGG + Intergenic
1173491873 20:43489272-43489294 CATGAGCCACCGCGCCGGGCTGG + Intergenic
1174204282 20:48827862-48827884 CTAGCGCGGCCGCGCGGCGCCGG + Exonic
1175014118 20:55770241-55770263 CTTGAGCCACCGCGCCCGGCTGG - Intergenic
1175421945 20:58840262-58840284 GTTGGGCAGCCGCGCGCTGCTGG - Intronic
1175888834 20:62307212-62307234 CTGGAGGAGCGGCGTGGGGCGGG - Intronic
1175992147 20:62794889-62794911 CTTGAGCCACCGCGCCCGGCCGG - Intergenic
1176214472 20:63941712-63941734 CTTGGGCAGCGGGGCGGGACGGG - Intronic
1176839330 21:13826308-13826330 CGTGAGCCGCCGCGCCCGGCCGG + Intergenic
1178485876 21:33020015-33020037 GCTGCGCAGCCCCGCGGGGCCGG + Intergenic
1178504678 21:33152926-33152948 CTTGAGCCACCGCGCCGGGCCGG - Intergenic
1179674931 21:42974810-42974832 TTTGACCCGCCGCCCGGGGCAGG + Intronic
1179877588 21:44278356-44278378 CCTGAGCAACCGCGCCCGGCCGG + Intergenic
1180645274 22:17333525-17333547 CGTGAGCCACCGCGCCGGGCCGG - Intergenic
1181478949 22:23185382-23185404 CTTGAGCCACCGCGCCCGGCCGG - Intronic
1182294457 22:29305029-29305051 CGTGAGCCGCCGCGCCCGGCCGG + Intergenic
1182321382 22:29480238-29480260 CCTGAGCAGGTGCGCGAGGCCGG - Exonic
1182357138 22:29727306-29727328 CGTCAGCAGCCGCGGGGGCCGGG + Intronic
1183395206 22:37567531-37567553 TCTGAGCAGCCGCCTGGGGCAGG - Intronic
1183607073 22:38872100-38872122 GGTGAGCCGCCGCCCGGGGCGGG - Exonic
1184038226 22:41928574-41928596 CCTGAGCAGCAGCGAGGGGGAGG + Intergenic
1184361910 22:44024136-44024158 CTTGAGCGGCGGCGCGGGACGGG + Intronic
1184464755 22:44662294-44662316 CTTCAGCAGCTGCAGGGGGCGGG + Intergenic
1185397485 22:50600480-50600502 CTGGAGGACCCGCGCGGGGCGGG - Intronic
949552122 3:5120137-5120159 CTTGAGCCACCGCGCCCGGCCGG - Intergenic
950053922 3:10010894-10010916 CTGGAGCAGCCGCGCCCGGCGGG + Intronic
951998452 3:28757209-28757231 CTGGAGCAGCGGCGGGAGGCAGG + Intergenic
954401281 3:50321167-50321189 CCTGAGCGGCCGGGCGGGGGAGG - Exonic
956406418 3:68932675-68932697 CCTGAGCAGGGGTGCGGGGCGGG - Intergenic
957083585 3:75658934-75658956 CGGGTGCAGCCGGGCGGGGCGGG + Intergenic
960599837 3:119445544-119445566 CTTGAGCCACCGCGCCCGGCGGG + Intronic
960809979 3:121618675-121618697 CTTGAGCCACCGCGCCTGGCTGG + Intronic
962207332 3:133445797-133445819 CTTGAGCATCCGTGGGGGACTGG + Intronic
965615126 3:170585613-170585635 CGGGAGCTGCCGGGCGGGGCGGG - Intronic
966768098 3:183480175-183480197 CATGAGCCGCCGTGCGCGGCCGG - Intergenic
966794599 3:183701364-183701386 CTTGAGCCACCGCGCCCGGCCGG + Intronic
966846614 3:184135436-184135458 CAAGCGCAGCGGCGCGGGGCCGG + Exonic
967884144 3:194321983-194322005 CTTGAGCAGCCGTGGGAGGGTGG + Intergenic
968551973 4:1228502-1228524 GTTGAGGGGCCGCGCGTGGCGGG - Intronic
968701055 4:2058646-2058668 CATGCGCGGCCGCGGGGGGCGGG + Intergenic
969035410 4:4249509-4249531 CGTGAGCCACCGCGCGCGGCTGG - Intergenic
969040287 4:4290367-4290389 CTTGCGAAGGCGTGCGGGGCTGG + Intronic
969391166 4:6892233-6892255 CCTGACCAGCAGCGTGGGGCAGG + Intergenic
969583871 4:8080891-8080913 CTGGGGCAGCCGGGAGGGGCGGG + Intronic
969841962 4:9889275-9889297 CTTGAGGAGCTGCCGGGGGCAGG + Intronic
972427153 4:38944349-38944371 CTTGAGCCACCGCGCCCGGCCGG + Exonic
975032100 4:69633962-69633984 CGTGAGCCACCGCGCGCGGCCGG - Intronic
977401082 4:96533203-96533225 CGTGAGCCACCGCGCCGGGCCGG + Intergenic
978812396 4:112864749-112864771 CTTGAGCCACCGCGCCCGGCTGG - Intronic
980382321 4:132038574-132038596 CTTGAGCCACCGCGCCCGGCCGG + Intergenic
980990502 4:139735079-139735101 CTCGCCCAGACGCGCGGGGCGGG - Intronic
984198733 4:176692111-176692133 CGTGAGCCACCGCGCCGGGCCGG - Intronic
985064731 4:186109126-186109148 CTTGAGCCACCGCGCCCGGCCGG + Intronic
985334161 4:188873508-188873530 CGTGAGCCCCCGCGCCGGGCCGG - Intergenic
986299726 5:6468325-6468347 CTGGAGCAGGGGCGCGGGGTGGG + Intronic
987085150 5:14461148-14461170 GCTGAGCCGCCGCACGGGGCTGG - Exonic
988164153 5:27561563-27561585 CATGAGCCGCCGCGCTCGGCCGG - Intergenic
992449197 5:76860453-76860475 CTTGAGCAGCTGAGAGGGTCGGG - Intronic
992558829 5:77929946-77929968 GTTGAGCAGCCGCCTGGTGCGGG - Intergenic
992627536 5:78648831-78648853 ACTGGGCAGCGGCGCGGGGCCGG - Intronic
1001117494 5:168951998-168952020 CTTGAGCAGCCAGGCGAGGTGGG - Intronic
1002070567 5:176676941-176676963 GTGGAGGAGCCGTGCGGGGCTGG - Intergenic
1002090000 5:176798711-176798733 CTCGGGGAGCCGCGCGGGGCAGG + Intergenic
1002487898 5:179551792-179551814 CTTGAGCCACCGCGCCCGGCCGG + Intronic
1005469643 6:26149926-26149948 CTTGAGCCACCGCGCCCGGCCGG - Intergenic
1005522138 6:26610851-26610873 CTTGAGCCACCGCGCCCGGCCGG - Intergenic
1005588561 6:27301047-27301069 CGTGAGCCGCCGCGCCGGGCCGG + Intronic
1006444131 6:34069433-34069455 CTGGAGCAGCCGCATGGGGAGGG - Intronic
1012258803 6:97063905-97063927 CTTGAGCAGCTGATCAGGGCTGG - Intronic
1012350160 6:98240534-98240556 CGTGAGCCACCGCGCAGGGCTGG - Intergenic
1013235457 6:108194548-108194570 CTTGAGCCACCGCGCCTGGCTGG + Intergenic
1014015658 6:116527234-116527256 CGTGAGCCACCGCGCCGGGCCGG - Intronic
1015773592 6:136792483-136792505 CTTGAGCTGCACCGCGGCGCAGG - Exonic
1017733612 6:157340099-157340121 CGTGAGCAGCCCAGCAGGGCAGG + Intergenic
1018030299 6:159836552-159836574 CTCGAGCAGCCGCGCGGGGGAGG + Intergenic
1018047316 6:159977340-159977362 CTTGTGCAGCTGCGTGGGGTAGG + Intronic
1018670305 6:166171529-166171551 CTAGAGCAGCAGGGAGGGGCCGG - Intergenic
1018702958 6:166441856-166441878 CTGGAGCAGCTGCCGGGGGCCGG + Intronic
1018876602 6:167827097-167827119 CCTCCTCAGCCGCGCGGGGCCGG - Exonic
1019068063 6:169319296-169319318 CTTGAGCCACCGCGCCTGGCCGG + Intergenic
1020081392 7:5287841-5287863 CTTGAGGAGCCCAGCGTGGCAGG + Exonic
1020676837 7:11193291-11193313 ACTGCGCAGCCGCGCGTGGCTGG - Intergenic
1021969349 7:25951358-25951380 ATAGAGCGGCCGCGCGGGGCTGG + Intergenic
1022094503 7:27130389-27130411 CTGGGGCGGCCGCCCGGGGCTGG + Exonic
1026817103 7:73521799-73521821 CTTTTCCAGCCGCGCGGGCCGGG - Intronic
1027248023 7:76380207-76380229 CGCGGGGAGCCGCGCGGGGCGGG - Intergenic
1030172669 7:106619724-106619746 CTTGAGCAGCTGGGAGGGGCAGG - Intergenic
1030532777 7:110730804-110730826 CGTGAGCCGCCGCGCCCGGCCGG + Intronic
1031200080 7:118670909-118670931 CATGAGCCACCGCGCCGGGCCGG + Intergenic
1032888530 7:136167944-136167966 CCTGAGCAACCGCGCCCGGCCGG + Intergenic
1034447979 7:151123095-151123117 CAGGAGCAGCCGGGCCGGGCGGG - Intronic
1041114740 8:54524493-54524515 CTTGAGCCACCGCGCCTGGCTGG + Intergenic
1042347837 8:67746159-67746181 CTTAAGCAGCCACCCGAGGCTGG + Exonic
1044232373 8:89794283-89794305 CTTGAGCCACCGCGCGTGGCCGG - Intergenic
1044712408 8:95071107-95071129 CTTGAGCCACCGCGCCCGGCCGG - Intronic
1046931810 8:119848901-119848923 CTTGAGCCACCGCGCCCGGCCGG - Intronic
1049997313 9:1045447-1045469 CGTGAGCCACCGCGCGCGGCCGG + Intergenic
1051265755 9:15307095-15307117 CTTAGGCAGCCGAGCGGAGCTGG - Exonic
1051656310 9:19385302-19385324 CGTGAGCCACCGCGCCGGGCCGG + Intergenic
1055731133 9:79280184-79280206 CTTGAGCAGCAGTGGTGGGCAGG + Intergenic
1056386351 9:86099813-86099835 CCTGAGCAGCGACGCGGAGCGGG + Intronic
1056476674 9:86959456-86959478 CTTGAGCCACCGCGCCCGGCTGG - Intergenic
1057278935 9:93696924-93696946 CGTGAGCCGCCGCGCCTGGCCGG - Intergenic
1057356059 9:94332430-94332452 CCTGCGCAGGCGCGCAGGGCAGG - Intergenic
1057470087 9:95349513-95349535 CGTGGGCAGCAGCGCGGGCCGGG + Intergenic
1057619117 9:96619450-96619472 CCCGAGCGCCCGCGCGGGGCTGG - Exonic
1059021220 9:110579097-110579119 CTTGTGCTGGCGCGCGCGGCGGG + Exonic
1059251347 9:112890304-112890326 CTTGAGCAGCAGCCCGAGGCGGG + Exonic
1060375453 9:123112322-123112344 CCCCAGCAGCCCCGCGGGGCAGG - Intronic
1060511580 9:124238477-124238499 CGTGAGCCACCGCGCTGGGCTGG + Intergenic
1060905624 9:127302221-127302243 CTTGAGCCACCGCGCTCGGCCGG + Intronic
1061089869 9:128420627-128420649 CTGGAGCAGCCCCGCCCGGCTGG - Exonic
1061089957 9:128420888-128420910 CTGGAGCAGCGGCGCGGCGCGGG - Exonic
1061986663 9:134134282-134134304 CGTGAGCCGCCGCGCCCGGCCGG + Intergenic
1062697249 9:137881684-137881706 CGTGAGCACACGCGTGGGGCTGG - Intronic
1186896310 X:14007806-14007828 CATGAGCCACCGCGCCGGGCCGG + Intergenic
1190414552 X:50167950-50167972 CGTGAGCAACCGCGCCCGGCAGG + Intergenic
1192358748 X:70425548-70425570 TTTGAGCAGCTGGGCAGGGCTGG - Intronic
1192746928 X:73948433-73948455 CTTGAGCCACCGCGCCCGGCCGG + Intergenic
1193032796 X:76917785-76917807 CTTGAGCCACCGCGCTGGCCTGG - Intergenic
1195104754 X:101593376-101593398 GTTGAGCAGCTGTGCTGGGCTGG + Intergenic
1197297497 X:124737036-124737058 CTGGAGCAGCTGGGCTGGGCTGG + Exonic
1198992147 X:142526771-142526793 CGTGAGCCACCGCGCGTGGCCGG + Intergenic
1199976519 X:152897872-152897894 CTCCAGCAGCCCCGCGGGGCGGG + Intergenic
1202013759 Y:20378509-20378531 CGTGAACAACCGCGCGTGGCCGG - Intergenic