ID: 1108676458

View in Genome Browser
Species Human (GRCh38)
Location 13:52741065-52741087
Sequence GAAATGTCCTGAGCCTGCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 219}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108676458 Original CRISPR GAAATGTCCTGAGCCTGCAT TGG Intergenic
900501479 1:3007502-3007524 GCAGTGTCCTGAGGCTGCACAGG - Intergenic
901203894 1:7483131-7483153 AATATGTCCTGAGCCTGCAGGGG - Intronic
901439967 1:9271970-9271992 GACATGCCCAGAGCCTGCAAGGG + Intergenic
901789463 1:11646774-11646796 GAAAGGACCGGAGCCTGCACTGG - Intergenic
902317290 1:15631632-15631654 GAAATGTCCTGTGTCTTGATTGG - Intronic
904435288 1:30490911-30490933 GACAAGTCCTGACCCTGCAAAGG + Intergenic
908674827 1:66591864-66591886 GAAAAGTGCTGTGCCTCCATGGG + Intronic
910141536 1:84031909-84031931 ACCATGTCCTGAGGCTGCATAGG + Intergenic
910654267 1:89604143-89604165 GAAATGTCCTGAGGTTGCACAGG + Intergenic
912558931 1:110536552-110536574 GCCATGTCCTGTGACTGCATGGG - Intergenic
912638092 1:111317914-111317936 GTGGTGTCCTGTGCCTGCATAGG + Intronic
912971613 1:114289252-114289274 CAAGAGTCCTGAGCCTGCACGGG + Intergenic
913958662 1:143323328-143323350 GACATGTCCTGGCCCTGCTTTGG - Intergenic
914052979 1:144148708-144148730 GACATGTCCTGGCCCTGCTTTGG - Intergenic
914126218 1:144817833-144817855 GACATGTCCTGGCCCTGCTTTGG + Intergenic
915285690 1:154850561-154850583 CAAATGTCCAAAGCCTGCAGAGG - Intronic
916290771 1:163164051-163164073 GAAATGTGCAGAGCCCGCTTGGG + Intronic
916316006 1:163448236-163448258 GAAATGTCCTGATCATGGAAGGG - Intergenic
916764107 1:167843730-167843752 GAAGTGGCCTGTGGCTGCATTGG - Intronic
917777479 1:178352928-178352950 GCAGTGTCCTGAGGCTGCATGGG + Intronic
918802823 1:188994992-188995014 GAAGTTTGCTGAGCCTGCAAAGG - Intergenic
919311644 1:195917305-195917327 GCAATGTCCTGAGGTTGCACAGG - Intergenic
919918910 1:202156721-202156743 GGAGTGTCCTCTGCCTGCATGGG - Intronic
919953114 1:202384607-202384629 AAAATGTCCTGAAATTGCATAGG + Intronic
921466900 1:215499207-215499229 GAGATGTCGGGAGCCTGAATGGG + Intergenic
922097866 1:222458003-222458025 GCAGTGTCCTGAGGCTGCATAGG - Intergenic
924767352 1:247046376-247046398 GCAGTGTCCTGAGGCTGCACAGG - Intronic
924933925 1:248752214-248752236 GAAGTGTTCTGTGCCTGCGTTGG - Intronic
1063081719 10:2773557-2773579 GAAATGCACTGAACCAGCATTGG + Intergenic
1065855502 10:29826968-29826990 AAAATTTCCTGAGCCTGGTTTGG - Intergenic
1066962619 10:42235509-42235531 GACATGTCCTGGTCCTGCTTTGG - Intergenic
1068252065 10:54455806-54455828 ACCATGTCCTGAGGCTGCATGGG - Intronic
1070398785 10:76034859-76034881 GAGATGTGCTGAGCCTGCACCGG - Intronic
1070952525 10:80442755-80442777 GAAATCTCATGGGCCTGTATGGG + Intergenic
1072775637 10:98189896-98189918 GAAATGTCCTTCTCCTGCACAGG - Intronic
1074441872 10:113484767-113484789 GAGATGGCCTGAGCAGGCATGGG - Intergenic
1077993296 11:7431670-7431692 GCAGTGTCCTGAGGCTGCACAGG - Intronic
1079416351 11:20239759-20239781 GAAATGTTCTGTGCCTTGATTGG - Intergenic
1079872866 11:25822174-25822196 GCATTGTCCTGAGGCTGCACAGG - Intergenic
1081649814 11:44816333-44816355 AAATTGTCCAGAGACTGCATTGG + Intronic
1084498704 11:69521530-69521552 GCAATGTCCTGAGGCTGCACAGG + Intergenic
1086865748 11:91978103-91978125 GAAATATCCTTATCCTGGATAGG - Intergenic
1087849262 11:103009634-103009656 GCAGTGTCCTGAGACTGCACAGG + Intergenic
1090544433 11:127747388-127747410 GCAGTGTTCTGAGGCTGCATAGG + Intergenic
1093483333 12:19627466-19627488 GAAAAGTCATGGGCCTGCCTGGG - Intronic
1093860618 12:24162089-24162111 GAAAAATCTTGAGCCTGGATTGG + Intergenic
1095186354 12:39204789-39204811 GAAATGCCCTTAGCCTGCGTAGG - Intergenic
1095464170 12:42473360-42473382 GAAATGTCATCAGCCTGCTATGG + Intronic
1095838856 12:46669836-46669858 GGAGTGTCCTGAGGCTGCAAGGG + Intergenic
1104897526 12:132171617-132171639 GAAAGCGCCTGAGCCTCCATCGG - Intergenic
1105488643 13:20863892-20863914 TAAATGACCTGAGCTTGAATAGG - Intronic
1107105383 13:36637154-36637176 ACAATGTCCTGAGGCTGCACAGG + Intergenic
1107662533 13:42653865-42653887 GAAATGTACAGATCCTGCAAAGG + Intergenic
1107972319 13:45655184-45655206 GCAGTGTCCTGAGGCTGCACAGG + Intergenic
1108433797 13:50381531-50381553 GCAGTGTCCTGAGCCAGAATAGG + Intronic
1108676458 13:52741065-52741087 GAAATGTCCTGAGCCTGCATTGG + Intergenic
1108828944 13:54452893-54452915 ACCATGTCCTGAGGCTGCATAGG + Intergenic
1109003362 13:56835600-56835622 GCAGTGTCCTGAGGCTGCACAGG + Intergenic
1112252254 13:97793027-97793049 GCAGTGTCCTGAGGCTGCATAGG + Intergenic
1112299454 13:98217019-98217041 GAAATGGCCTGGGCGGGCATAGG - Intronic
1112363508 13:98738476-98738498 GCAGTGTCCTGAGGCTGCATAGG - Intronic
1114410574 14:22496742-22496764 GAACTGTCCTGACCTTGCAAAGG + Intergenic
1114689026 14:24563232-24563254 GCAGTGTCCTGAGGCTGCACAGG - Intergenic
1115140836 14:30169063-30169085 GAAGTGTCCTGAAGCGGCATAGG + Intronic
1115916579 14:38321595-38321617 GAAGTGTCCTGAGGCTGCACAGG + Intergenic
1117886710 14:60371755-60371777 GCAATGTCCTGAGGCTGCACAGG - Intergenic
1118683230 14:68264882-68264904 GAAATGTGTGGAGGCTGCATCGG + Intronic
1120049768 14:79851738-79851760 GAAATGGCCTCAGCCTCCACTGG - Intronic
1121558725 14:94858338-94858360 GAAATAGCCTGAGCATGCAGGGG - Intergenic
1122129766 14:99598241-99598263 GCAAGTTCCTGAGCCTCCATGGG - Intronic
1122882697 14:104697152-104697174 GACATGTTCTGAGTCTGCCTGGG - Intronic
1202929747 14_KI270725v1_random:26864-26886 GAAATGTCCTGGCCCTGCTTTGG + Intergenic
1123422557 15:20144380-20144402 GATATGTCCTGGCCCTGCTTTGG - Intergenic
1123442457 15:20301984-20302006 GACATGTCCTGGCCCTGCTTTGG + Intergenic
1123531785 15:21150920-21150942 GATATGTCCTGGCCCTGCTTTGG - Intergenic
1125928013 15:43579046-43579068 GGAATGTCCTCAGCCTCCGTGGG + Exonic
1125941157 15:43678617-43678639 GGAATGTCCTCAGCCTCCGTGGG + Intergenic
1129010093 15:72408022-72408044 GAAATGTCTTTTGCGTGCATTGG + Exonic
1129699854 15:77761598-77761620 GGAATGTCCTGTGCCTGACTTGG - Intronic
1129758088 15:78110695-78110717 CACATGTACTGAGCCTGAATTGG + Intronic
1131582816 15:93661899-93661921 AAAATCTCCTGAGGCTGCAGGGG + Intergenic
1133151610 16:3836544-3836566 GAAATGTCCTGAATCTTGATAGG + Intronic
1133208092 16:4246226-4246248 GAAGTGTCCTGTCCCTGCATGGG + Intergenic
1135416499 16:22272460-22272482 GAAATGTCCAGATCCAGAATAGG + Intronic
1136718762 16:32303560-32303582 GACATGTCCTGGCCCTGCTTTGG - Intergenic
1136837133 16:33509824-33509846 GACATGTCCTGGCCCTGCTTTGG - Intergenic
1138099514 16:54241333-54241355 CAGTTGTCCTGAGCCTGCAGAGG - Intergenic
1203007669 16_KI270728v1_random:214211-214233 GACATGTCCTGGCCCTGCTTTGG + Intergenic
1203147309 16_KI270728v1_random:1810103-1810125 GACATGTCCTGGCCCTGCTTTGG - Intergenic
1145258533 17:21341133-21341155 GAAGTGTCCTGTGGCTGCAGGGG + Intergenic
1148171863 17:45527737-45527759 GCAATGTCATGCGCATGCATAGG + Intergenic
1148212374 17:45816391-45816413 GGAATGTCCTCTGCCTGCCTGGG + Intronic
1148364158 17:47040827-47040849 GCAATGTCATGCGCATGCATAGG - Intronic
1150866032 17:68850882-68850904 GCAAAATCCTGAGCATGCATAGG + Intergenic
1152704965 17:81838717-81838739 GAAATTTCCTGGACCTGCGTTGG + Intergenic
1153556875 18:6323992-6324014 GCAGTGTCCTGAGGCTGCACAGG - Intronic
1153751966 18:8241587-8241609 GAAATGACTTGAACCTCCATGGG + Intronic
1155561189 18:27079010-27079032 GCAATGTCCTGTGCATGCTTGGG + Intronic
1155773310 18:29727024-29727046 GCAGTGTCCTGAGGCTGCCTAGG - Intergenic
1156370088 18:36465411-36465433 GAAATGACCTGGGCCTGGACTGG + Intronic
1157689200 18:49667194-49667216 GAAATGTCCAGAGCCAGCACCGG - Intergenic
1157993032 18:52520259-52520281 GAAATGTCTTGACCATTCATAGG - Intronic
1158569014 18:58580830-58580852 GTAATGTCCTGACCCTGCCATGG - Intronic
1158904803 18:62001474-62001496 GCAGTGTCCTGAGGCTGCACAGG + Intergenic
1159289080 18:66393307-66393329 GAAATGTCTAGAGCTTACATTGG - Intergenic
1160052025 18:75442648-75442670 GAATTGTCCTATGCCTGCTTGGG + Intergenic
1164597459 19:29539605-29539627 CACATGTCCTGAGCCTGTAACGG - Intronic
1165769098 19:38368026-38368048 GAGATGACCTGGGCCTGCACAGG + Exonic
1166017485 19:39993829-39993851 GACATGTCCTGAGGCTGCACAGG - Intronic
1166499477 19:43330198-43330220 GCAGTGTCCTGAGGCTGCACAGG + Intergenic
1168608283 19:57777273-57777295 GAGTTGTTCTGAGCCAGCATTGG + Intronic
1168665839 19:58204216-58204238 GACACGTCCTGGGCCTACATGGG - Intronic
1202692375 1_KI270712v1_random:101131-101153 GACATGTCCTGGCCCTGCTTTGG - Intergenic
925539660 2:4952884-4952906 AAAGTGTCCTGAGGCTGCACAGG + Intergenic
925680404 2:6415294-6415316 GAGATGTCCACAGCCTGCAAAGG + Intergenic
926467202 2:13205863-13205885 GCAGTGTCCTGAGGCTGCATGGG - Intergenic
933954020 2:87352840-87352862 GACATGTCCTGGCCCTGCTTTGG + Intergenic
934238225 2:90249083-90249105 GACATGTCCTGGCCCTGCTTTGG + Intergenic
934274974 2:91567650-91567672 GACATGTCCTGGCCCTGCTTTGG - Intergenic
934322343 2:91981610-91981632 GACATGTCCTGGTCCTGCTTTGG + Intergenic
934460643 2:94212422-94212444 TAAATGTCCTGGCCCTGCTTTGG + Intergenic
937019267 2:118635291-118635313 GAAATATCCTGAATTTGCATAGG + Intergenic
937956559 2:127424952-127424974 CAAATGTCCACAGCCTGCACAGG - Intronic
940010903 2:149053797-149053819 GAAATGTCCAGAGCAGGCAAAGG - Intronic
940149065 2:150578904-150578926 GCAGTGTCCTGAGGCTGCACAGG + Intergenic
940201789 2:151159428-151159450 GAAATGTCATGAGCCTTCCCTGG - Intergenic
941257217 2:163247242-163247264 GAATTGTCTCCAGCCTGCATTGG + Intergenic
942377908 2:175355954-175355976 GGAATGCCCTGAGCCTGTAAAGG + Intergenic
942775572 2:179577520-179577542 GAAATATACTGGGCATGCATGGG - Intronic
944491508 2:200262724-200262746 GCAGTGTCCTGAGGCTGCATGGG - Intergenic
947889666 2:233605768-233605790 GCAGTGTCCTGAGGCTGCACAGG + Intergenic
1170481867 20:16774177-16774199 GCAGTGTCCTGAGGCTGCACAGG - Intergenic
1170593814 20:17790856-17790878 GAAGTGTGCTTAGCCTGCAAGGG + Intergenic
1170791420 20:19512358-19512380 GGACTGTCCCGAGCCAGCATGGG + Intronic
1170897782 20:20431447-20431469 GAAATGTCCTCTACCTGCCTGGG - Intronic
1175556043 20:59857688-59857710 GCAGTGTCCTGAGGCTGCACAGG - Intergenic
1176041122 20:63066389-63066411 GGAGTGTCCGCAGCCTGCATGGG - Intergenic
1176591769 21:8655463-8655485 GAAATGTCCTGGCCCTGCTTTGG + Intergenic
1180274616 22:10632575-10632597 GAAATGTCCTGGCCCTGCTTTGG + Intergenic
1180549096 22:16527519-16527541 GACATGTCCTGGTCCTGCTTTGG + Intergenic
1181355603 22:22294333-22294355 GACATGTCCTGGCCCTGCTTTGG - Intergenic
1181883163 22:25997606-25997628 GAAATGTGTTGAGACTTCATGGG - Intronic
1184404633 22:44292941-44292963 TAAATGGCTTGAGGCTGCATAGG - Intronic
1184803469 22:46776620-46776642 GAACTGGCCTGAGATTGCATGGG + Intronic
949341089 3:3031728-3031750 GAAAACCCCTGAGCATGCATAGG - Intronic
951937015 3:28033157-28033179 GCAGTGTCCTGAGACTGCGTAGG - Intergenic
952221414 3:31327503-31327525 GTAGTGTCCTGAGGCTGCACTGG + Intergenic
956063902 3:65376731-65376753 TCAATGTCCTCAGCCTGAATAGG - Intronic
956700456 3:71954478-71954500 GAAATGTGCTGAGTCTGTTTGGG - Intergenic
956887222 3:73572436-73572458 GAAATGTCATTAGCATCCATTGG + Intronic
956932145 3:74055746-74055768 GGGATGTCCTGAGCATGAATGGG - Intergenic
958004888 3:87798205-87798227 GAACTGTCCTGAGACTGAAGGGG - Intergenic
959935281 3:112022628-112022650 GCAATGTCCTGAGGCTGCTCAGG - Intergenic
960244074 3:115380393-115380415 GCAATATCCTGAGGCTGCACAGG + Intergenic
961010714 3:123433961-123433983 GTCATTTCCTGAGCCGGCATTGG - Intronic
961058727 3:123810614-123810636 GAACTGTCCTGAGCCTGTTGGGG - Intronic
969201569 4:5610617-5610639 GCAATGCCCTGAGCCTGTCTTGG - Intronic
969992961 4:11283271-11283293 GAAATGTGTTGAGACTTCATGGG - Intergenic
970922567 4:21412123-21412145 GAATTGTCCAGAGCCTGGATTGG + Intronic
971545488 4:27880204-27880226 GCAGTGTCCTGAGGCTGCACAGG + Intergenic
971847092 4:31932871-31932893 GAAATGTCCTGGGACAGCAAAGG + Intergenic
972367770 4:38392454-38392476 GCAGTGTCCTGAGGCTGCACAGG - Intergenic
972390059 4:38605868-38605890 AAAGTCTCCTGACCCTGCATAGG + Intergenic
972829921 4:42802897-42802919 GCAGTGTCCTGAGGCTGCACAGG + Intergenic
973665360 4:53153460-53153482 GCAGTGTCCTGAGGCTGCATAGG + Intronic
975090395 4:70395184-70395206 GAAATGTGCTGCCCCTGCTTTGG + Intergenic
977191732 4:94009416-94009438 GAAATGTCCTTGCCCTGCAGGGG + Intergenic
978417208 4:108489103-108489125 GAAATGGTCTGACCCTGCTTTGG - Intergenic
978867134 4:113526853-113526875 AAAATGCCCAGATCCTGCATGGG - Intronic
979606472 4:122643918-122643940 GAAATGTCCTGGGCTTGGTTTGG - Intergenic
979820231 4:125161561-125161583 GCAGTGTCCTGAGGCTGCACAGG + Intergenic
984065566 4:175043738-175043760 GCAGTGTCCTGAGGCTGCACAGG - Intergenic
985386352 4:189452197-189452219 GTAGTGTCCTGAGGCTGCACAGG - Intergenic
986516931 5:8574144-8574166 GAAATGGCCTGGGGCTGCCTGGG + Intergenic
986823525 5:11496006-11496028 GAAAAGACCTGAGACAGCATGGG - Intronic
990417189 5:55597842-55597864 GGAAAGTCCTGAGCCTCCAAAGG + Intergenic
993344722 5:86768948-86768970 GCAGTGTCCTGAGGCTGCACAGG + Intergenic
996483401 5:124001382-124001404 CAAAATTCCTGAGCCTGCAAAGG - Intergenic
998745831 5:145258945-145258967 GCAATGTCCTGAGACTGCACAGG - Intergenic
999571591 5:152925614-152925636 GCAGTGTCCTGAGGCTGCACAGG - Intergenic
1000788081 5:165570849-165570871 ACCATGTCCTGAGGCTGCATAGG + Intergenic
1001687005 5:173600942-173600964 CAAAGGTCCAGAGTCTGCATTGG + Intergenic
1001944455 5:175767109-175767131 GCAGTGTCCTGAGGCTGCACAGG + Intergenic
1002002982 5:176208573-176208595 GCAGTGTCCTGAGGCTGCACAGG + Intergenic
1003277261 6:4663330-4663352 GAAATGTCCCAAGCCAGCTTAGG + Intergenic
1006283738 6:33077626-33077648 GAAATGTCCTGAGAGTACAATGG - Intronic
1011504683 6:88028554-88028576 GCAGTGTCCTGAGACTGCACAGG + Intergenic
1013280607 6:108633250-108633272 GAAAAATCCTTAGCCTGCTTTGG + Intronic
1015598947 6:134893919-134893941 GATATGTTCTGAGACTTCATTGG - Intergenic
1018008715 6:159648285-159648307 GTACTGTCCTTGGCCTGCATGGG - Intergenic
1018411843 6:163557313-163557335 GAAATGTCCTGTGTCTTCAATGG + Intronic
1021925957 7:25533786-25533808 GAAATGTCCTGGGCCAGAAGAGG + Intergenic
1025101525 7:56139425-56139447 GAAATGTCCTGGGGCTGGACAGG + Intergenic
1028735008 7:94199073-94199095 GAAATGTACAGAGCTTGCCTAGG - Intergenic
1029120074 7:98261882-98261904 GCAGTGTCCTGAGGCTGCACAGG + Intronic
1033579046 7:142715212-142715234 CAAATGTCCTCAGCCTGAGTTGG + Intergenic
1036752296 8:11451016-11451038 GAAATGACCTCATCCTGCACTGG - Intronic
1037138926 8:15496572-15496594 GAAATGTGCTGAGCCTGGTAAGG - Intronic
1040484476 8:47856990-47857012 CAAATGGCCTCAGCCTGCTTTGG - Intronic
1043101969 8:76058846-76058868 GCAGTGTCCTGAGGCTGCACAGG - Intergenic
1044152657 8:88800713-88800735 GCCATGTCCTGAGGCTGCACAGG - Intergenic
1045561793 8:103271294-103271316 GAAATGTCCTGAGGTTGCACAGG - Intergenic
1049075700 8:140394653-140394675 GAACTGACCTCAGCCTGCGTTGG + Intronic
1049259468 8:141631056-141631078 GAAATGTCCTGGAACAGCATGGG + Intergenic
1049259674 8:141632137-141632159 GAAATGTCCTGGAACAGCATGGG + Intergenic
1049259889 8:141633263-141633285 GAAATGTCCTGGAACAGCATGGG + Intergenic
1049260101 8:141634389-141634411 GAAATGTCCTGGAACAGCATGGG + Intergenic
1049805478 8:144536847-144536869 GCACTGTTCTGGGCCTGCATGGG + Intronic
1053169891 9:35871113-35871135 GGAATGTCCTCGGCCTGCAGTGG + Intergenic
1053691141 9:40588119-40588141 GAAATGTCCTGGCTCTGCTTTGG + Intergenic
1054273663 9:63049372-63049394 GAAATGTCCTGGCTCTGCTTTGG - Intergenic
1054302401 9:63389090-63389112 GAAATGTCCTGGCTCTGCTTTGG + Intergenic
1054401171 9:64715584-64715606 GAAATGTCCTGGCTCTGCTTTGG + Intergenic
1054434782 9:65199910-65199932 GAAATGTCCTGGCTCTGCTTTGG + Intergenic
1054495607 9:65821771-65821793 GAAATGTCCTGGCTCTGCTTTGG - Intergenic
1056695426 9:88846337-88846359 GCAGTGTCCTGAGACTGCACAGG - Intergenic
1058209159 9:102145946-102145968 GATTTGTCCTAAGCCTTCATTGG + Intergenic
1058648023 9:107148697-107148719 GAGATGTCCTGAAGCTGCTTTGG - Intergenic
1058741329 9:107945465-107945487 AAATTCTCCTGAGCCTGCAAAGG + Intergenic
1061547125 9:131310912-131310934 GCATTGTCCTGAGCCAGCACCGG - Intergenic
1203621796 Un_KI270749v1:134227-134249 GAAATGTCCTGGACCTGCTTTGG + Intergenic
1203621811 Un_KI270749v1:134282-134304 GAAATGTCCTGGACCTGCTTTGG + Intergenic
1186274762 X:7927285-7927307 GAAGTGTCCCGGGGCTGCATTGG - Exonic
1187120649 X:16403128-16403150 AAAATGTCCTGTGCATCCATGGG - Intergenic
1188082099 X:25855917-25855939 GAAATGTCTGGAGCCTGAAATGG - Intergenic
1188166608 X:26871211-26871233 GCAGTGTCCTGAGGCTGCACAGG + Intergenic
1189011788 X:37053315-37053337 GCAGTGTCCTGAGGCTGCACAGG - Intergenic
1189036921 X:37502971-37502993 GCAGTGTCCTGAGGCTGCACAGG + Intronic
1189594404 X:42548696-42548718 GCAGTATCCTGAGGCTGCATAGG + Intergenic
1189872033 X:45394019-45394041 GAAGTGTTCTGAGGCTGCACAGG + Intergenic
1190320235 X:49175770-49175792 GCAGTGTCCTGAGCAGGCATGGG + Exonic
1194048063 X:89033879-89033901 GCAGTGTTCTGAGGCTGCATAGG + Intergenic
1194192759 X:90857726-90857748 GCAGTGTCCTGAGGCTGCAGTGG - Intergenic
1195527494 X:105908893-105908915 GCACTGTCCAGAGCCTGCAGTGG - Exonic
1197385470 X:125796157-125796179 GCAGTGTCCTGAGGCTGCACAGG - Intergenic
1197815434 X:130493494-130493516 GAAATGTCCTCTGCCTCCTTGGG - Intergenic
1197855644 X:130911127-130911149 GGACTGTCATGAGCCTCCATGGG - Intergenic
1198553675 X:137770289-137770311 CAAATGTAGTGAACCTGCATTGG + Intergenic
1198554162 X:137775113-137775135 CAAATGTAGTGAACCTGCATTGG - Intergenic
1199085171 X:143619923-143619945 AAAATGTCCTTATGCTGCATTGG + Intergenic
1199620037 X:149691681-149691703 GAAATCTCCAGAGCTTACATGGG - Intronic
1200539387 Y:4440175-4440197 GCAGTGTCCTGAGGCTGCAGTGG - Intergenic
1201189831 Y:11436785-11436807 GACATGTCCTGGTCCTGCTTTGG + Intergenic
1202581537 Y:26386659-26386681 AAAATGTCCTGAAATTGCATAGG - Intergenic
1202583798 Y:26405153-26405175 GACATGTCCTGGACCTGCTTTGG - Intergenic