ID: 1108679987

View in Genome Browser
Species Human (GRCh38)
Location 13:52771819-52771841
Sequence GATCCATGGGTGTGTGTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108679987_1108679992 -8 Left 1108679987 13:52771819-52771841 CCTGAGACACACACCCATGGATC No data
Right 1108679992 13:52771834-52771856 CATGGATCTGAGGCACTAGAGGG No data
1108679987_1108679995 -3 Left 1108679987 13:52771819-52771841 CCTGAGACACACACCCATGGATC No data
Right 1108679995 13:52771839-52771861 ATCTGAGGCACTAGAGGGGCGGG No data
1108679987_1108679997 6 Left 1108679987 13:52771819-52771841 CCTGAGACACACACCCATGGATC No data
Right 1108679997 13:52771848-52771870 ACTAGAGGGGCGGGAGAAGAGGG No data
1108679987_1108679996 5 Left 1108679987 13:52771819-52771841 CCTGAGACACACACCCATGGATC No data
Right 1108679996 13:52771847-52771869 CACTAGAGGGGCGGGAGAAGAGG No data
1108679987_1108679991 -9 Left 1108679987 13:52771819-52771841 CCTGAGACACACACCCATGGATC No data
Right 1108679991 13:52771833-52771855 CCATGGATCTGAGGCACTAGAGG No data
1108679987_1108679998 10 Left 1108679987 13:52771819-52771841 CCTGAGACACACACCCATGGATC No data
Right 1108679998 13:52771852-52771874 GAGGGGCGGGAGAAGAGGGCAGG No data
1108679987_1108679994 -4 Left 1108679987 13:52771819-52771841 CCTGAGACACACACCCATGGATC No data
Right 1108679994 13:52771838-52771860 GATCTGAGGCACTAGAGGGGCGG No data
1108679987_1108679993 -7 Left 1108679987 13:52771819-52771841 CCTGAGACACACACCCATGGATC No data
Right 1108679993 13:52771835-52771857 ATGGATCTGAGGCACTAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108679987 Original CRISPR GATCCATGGGTGTGTGTCTC AGG (reversed) Intergenic
No off target data available for this crispr