ID: 1108680313

View in Genome Browser
Species Human (GRCh38)
Location 13:52774446-52774468
Sequence CTGTGTGTATATGAAGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108680309_1108680313 28 Left 1108680309 13:52774395-52774417 CCAGGAAGACTGGTGTACAAATA No data
Right 1108680313 13:52774446-52774468 CTGTGTGTATATGAAGAAGTGGG No data
1108680311_1108680313 -7 Left 1108680311 13:52774430-52774452 CCTGCTTTCAGTTCTTCTGTGTG No data
Right 1108680313 13:52774446-52774468 CTGTGTGTATATGAAGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108680313 Original CRISPR CTGTGTGTATATGAAGAAGT GGG Intergenic
No off target data available for this crispr