ID: 1108681391

View in Genome Browser
Species Human (GRCh38)
Location 13:52783578-52783600
Sequence CAGTCTCCCTGGGCCCTCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108681391_1108681395 2 Left 1108681391 13:52783578-52783600 CCCAAGAGGGCCCAGGGAGACTG No data
Right 1108681395 13:52783603-52783625 AACCAAGAAGAACTGAGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108681391 Original CRISPR CAGTCTCCCTGGGCCCTCTT GGG (reversed) Intergenic
No off target data available for this crispr