ID: 1108681520

View in Genome Browser
Species Human (GRCh38)
Location 13:52784779-52784801
Sequence CATGGACCTTTTTGTGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108681515_1108681520 4 Left 1108681515 13:52784752-52784774 CCTATTCATAGGTTCTGGGAATT No data
Right 1108681520 13:52784779-52784801 CATGGACCTTTTTGTGGAGCAGG No data
1108681513_1108681520 6 Left 1108681513 13:52784750-52784772 CCCCTATTCATAGGTTCTGGGAA No data
Right 1108681520 13:52784779-52784801 CATGGACCTTTTTGTGGAGCAGG No data
1108681514_1108681520 5 Left 1108681514 13:52784751-52784773 CCCTATTCATAGGTTCTGGGAAT No data
Right 1108681520 13:52784779-52784801 CATGGACCTTTTTGTGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108681520 Original CRISPR CATGGACCTTTTTGTGGAGC AGG Intergenic
No off target data available for this crispr