ID: 1108684802

View in Genome Browser
Species Human (GRCh38)
Location 13:52809485-52809507
Sequence GGCCCCAGGTGACCACAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108684802_1108684812 23 Left 1108684802 13:52809485-52809507 CCACCTTGTGGTCACCTGGGGCC No data
Right 1108684812 13:52809531-52809553 CTCTCTCTGTCTAGCTTCTTTGG No data
1108684802_1108684808 -3 Left 1108684802 13:52809485-52809507 CCACCTTGTGGTCACCTGGGGCC No data
Right 1108684808 13:52809505-52809527 GCCAAACAGGGTCATTCCTTGGG No data
1108684802_1108684807 -4 Left 1108684802 13:52809485-52809507 CCACCTTGTGGTCACCTGGGGCC No data
Right 1108684807 13:52809504-52809526 GGCCAAACAGGGTCATTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108684802 Original CRISPR GGCCCCAGGTGACCACAAGG TGG (reversed) Intergenic
No off target data available for this crispr