ID: 1108689118

View in Genome Browser
Species Human (GRCh38)
Location 13:52846575-52846597
Sequence ACTTCTAGGGAGCCATTGGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 111}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108689112_1108689118 -10 Left 1108689112 13:52846562-52846584 CCCAGGCACCGCCACTTCTAGGG 0: 1
1: 0
2: 0
3: 5
4: 89
Right 1108689118 13:52846575-52846597 ACTTCTAGGGAGCCATTGGCTGG 0: 1
1: 0
2: 1
3: 3
4: 111
1108689107_1108689118 15 Left 1108689107 13:52846537-52846559 CCACAACCGTGTCCTTTGCGGTG 0: 1
1: 0
2: 1
3: 2
4: 47
Right 1108689118 13:52846575-52846597 ACTTCTAGGGAGCCATTGGCTGG 0: 1
1: 0
2: 1
3: 3
4: 111
1108689108_1108689118 9 Left 1108689108 13:52846543-52846565 CCGTGTCCTTTGCGGTGCGCCCA 0: 1
1: 0
2: 0
3: 0
4: 53
Right 1108689118 13:52846575-52846597 ACTTCTAGGGAGCCATTGGCTGG 0: 1
1: 0
2: 1
3: 3
4: 111
1108689110_1108689118 3 Left 1108689110 13:52846549-52846571 CCTTTGCGGTGCGCCCAGGCACC 0: 1
1: 0
2: 0
3: 2
4: 64
Right 1108689118 13:52846575-52846597 ACTTCTAGGGAGCCATTGGCTGG 0: 1
1: 0
2: 1
3: 3
4: 111
1108689105_1108689118 27 Left 1108689105 13:52846525-52846547 CCTGCACACGGGCCACAACCGTG 0: 1
1: 0
2: 0
3: 5
4: 81
Right 1108689118 13:52846575-52846597 ACTTCTAGGGAGCCATTGGCTGG 0: 1
1: 0
2: 1
3: 3
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108689118 Original CRISPR ACTTCTAGGGAGCCATTGGC TGG Exonic
904655249 1:32040733-32040755 ACTTCCAGAGAGTCCTTGGCAGG + Intronic
906620553 1:47274628-47274650 ACTTTTAGGGATCATTTGGCAGG + Intronic
906621717 1:47286393-47286415 ACTTTTAGGGATCATTTGGCAGG - Intronic
907439901 1:54472719-54472741 GCTGCTGGGGAGCCATGGGCTGG + Intergenic
907690797 1:56663436-56663458 ACCTCTTGGTAGCCATTGTCAGG + Intronic
911715899 1:101132694-101132716 TCTTCTAATAAGCCATTGGCAGG - Intergenic
913283279 1:117205752-117205774 TCTCCTAGGCAGCCAATGGCAGG - Intronic
916244624 1:162675044-162675066 ACTACTAGGGAGCCTGAGGCAGG + Intronic
917963071 1:180159830-180159852 ATTTCTAGGAGGCCATTGGTTGG - Intronic
920818373 1:209356678-209356700 ATTTCAAGAGTGCCATTGGCTGG - Intergenic
924356660 1:243184512-243184534 ACTTTTAGAGACCCATTGTCTGG - Intronic
924391149 1:243559954-243559976 AGTGTTAGGGAGCGATTGGCAGG - Intronic
924498767 1:244616015-244616037 ACTTCTAGGGAGGCTGAGGCAGG + Intronic
1064471302 10:15638878-15638900 ACTTCTTGGGAGCCTGAGGCGGG + Intronic
1067115119 10:43429513-43429535 ACTACTAGGGAGCCTGAGGCAGG + Intergenic
1068236646 10:54243393-54243415 GCTACTAGGGAGGCATAGGCAGG + Intronic
1073293232 10:102423656-102423678 CCTCCTTGGGAGCCATGGGCCGG + Exonic
1074138386 10:110648378-110648400 ACTGTTAGGGAGTCATTCGCAGG + Intronic
1074659898 10:115642553-115642575 ACTACTAGGGAGGCTTAGGCAGG - Intronic
1075200882 10:120402949-120402971 ACTACTAGGGAGGCAGAGGCAGG + Intergenic
1076834989 10:133016509-133016531 ACTCCTGGAGAGCCATGGGCTGG - Intergenic
1078658873 11:13268521-13268543 ACTTGCTGGGAGCCATAGGCAGG + Intergenic
1078970776 11:16408786-16408808 ACTGCTAGGGAGCCTGAGGCAGG - Intronic
1082694559 11:56345437-56345459 GCTTCTAGTGAGCAATTGGGGGG - Intergenic
1083493004 11:63027001-63027023 GCTTCTAGGGAGGCCTAGGCAGG - Intergenic
1086371897 11:86163500-86163522 ACTTCTAGGGCTCCACTGTCTGG + Intergenic
1091436975 12:480797-480819 ATCTCTGGGGAGCCTTTGGCGGG + Intronic
1096865846 12:54562302-54562324 AGCTCTAGGCAGCCATTGGGAGG - Intronic
1105611514 13:21973654-21973676 GGTTCTTGGGAGCCAATGGCAGG - Intergenic
1108031060 13:46230214-46230236 ACTTTTGGGGAACTATTGGCAGG - Intronic
1108689118 13:52846575-52846597 ACTTCTAGGGAGCCATTGGCTGG + Exonic
1114644481 14:24246999-24247021 ACTTCTGGGGAGCCAGTACCAGG - Intergenic
1114874860 14:26703391-26703413 ACTTCTAGGGACCAAATTGCTGG + Intergenic
1116852212 14:49919638-49919660 GCTTCTAGGGAGCCTGAGGCAGG + Intergenic
1124051525 15:26201201-26201223 ACATCAAGGGAGTCTTTGGCTGG - Intergenic
1125017932 15:34955795-34955817 ACTTCTAGGGAGGCTGAGGCAGG + Intronic
1125306864 15:38327225-38327247 ACTTTTAGGGAGTCATGGGAGGG + Intronic
1131558941 15:93422915-93422937 ACTTCTGTGGATACATTGGCAGG + Intergenic
1133106474 16:3513364-3513386 ACTTCTTGGCTGGCATTGGCTGG - Intronic
1133313948 16:4870544-4870566 AGCTCAAGGAAGCCATTGGCAGG + Exonic
1134302529 16:13004465-13004487 AGTGCTAGGAAGCCATTGGAAGG + Intronic
1134353977 16:13463854-13463876 AATTCCAGGGAGCCAACGGCAGG - Intergenic
1135795582 16:25438864-25438886 GCTACTCGGGAGGCATTGGCAGG - Intergenic
1136089049 16:27905255-27905277 ACTTCTACTGAGCACTTGGCTGG + Intronic
1137589234 16:49683280-49683302 ACTTCCAGGGTGCAATTTGCTGG - Intronic
1137724047 16:50645263-50645285 ACTTCTGGGGAGACATGGGAGGG + Intergenic
1140248076 16:73269261-73269283 ACCACCAGGGAGCCATTGGATGG + Intergenic
1141507422 16:84487027-84487049 ACTTCTGGGGCCCCAGTGGCTGG - Exonic
1144725063 17:17497683-17497705 AAAACTAGGGAGCCATTAGCTGG + Intergenic
1149764016 17:59259635-59259657 ACTTCTAGGGAGGCTGAGGCAGG + Intronic
1152225657 17:79091480-79091502 GCTTCTGGGGAGACACTGGCTGG - Intronic
1154310007 18:13260031-13260053 ATTTCTTGGGAGGCATTGGGTGG + Intronic
1158309661 18:56144608-56144630 TCTTCTAGGGAGGCATGGGAAGG + Intergenic
1163863639 19:19755273-19755295 ACTTCTAGGCCGCCACTGACTGG + Intergenic
1164243516 19:23410498-23410520 ACTACTAGGGAGGCTGTGGCAGG + Intergenic
1164566205 19:29327681-29327703 TCTGCCAGGGAGGCATTGGCTGG - Intergenic
1164581482 19:29438106-29438128 ACTTCTTGGGATCCATTTGTTGG - Intergenic
925693951 2:6554323-6554345 CCTCCGATGGAGCCATTGGCTGG + Intergenic
930629723 2:53739104-53739126 ATTTCTAGGGAGACATTTTCTGG + Intronic
930765888 2:55084710-55084732 ACTTCTTGGCAGACATTGACTGG - Intronic
936964480 2:118114147-118114169 ACTTCTAAAGAGCCATTGCAGGG + Intergenic
938450093 2:131410858-131410880 ACTACTATGCAGCCATTTGCAGG + Intergenic
940639896 2:156334230-156334252 AGTTCCACGGAGCCATCGGCCGG - Intronic
945810692 2:214546332-214546354 AGATCTAGGGAGCATTTGGCTGG - Intronic
1171432729 20:25094348-25094370 ACTACTAGGGAGGCAAAGGCAGG + Intergenic
1173279295 20:41613867-41613889 ACCCCTAGGGAGTCTTTGGCTGG - Intronic
1174044595 20:47724510-47724532 CCTTCTAGGGAGCGGATGGCTGG - Intronic
1179548334 21:42126711-42126733 ACTTCCAGTGAGCCACTGGCAGG + Intronic
1184712144 22:46257601-46257623 ACTTCAAGAAAGCAATTGGCTGG - Exonic
950686666 3:14623225-14623247 ACTGCCAGGGAGGCATTAGCTGG + Intergenic
957628527 3:82687133-82687155 AGTTCTAGGAAGCTTTTGGCAGG + Intergenic
961084474 3:124054888-124054910 ACTTCTAGAGATCCTTTGGTTGG - Intergenic
961206565 3:125087204-125087226 ACTTCTAGGGAGGCTGAGGCAGG - Intronic
964063429 3:152553464-152553486 ACTTCCACCGAGCCATTTGCTGG - Intergenic
964407934 3:156369064-156369086 TCTTCTAGGGAGGCAGTGGGTGG - Intronic
968003632 3:195224715-195224737 AGTTCTAGGGAGCCAGGGGGAGG - Intronic
969646205 4:8430934-8430956 ATTTCTAGGTAGACATTGGAAGG + Intronic
974929543 4:68346301-68346323 GCTACTAGGGAGCCCTTGGGAGG + Intronic
979245160 4:118495091-118495113 ACTTTTAGAGACCCATTGTCTGG + Intergenic
982035311 4:151340176-151340198 GCTACTTGGGAGCCTTTGGCAGG + Intergenic
982126577 4:152188999-152189021 ATTTCTAGGCAGCCACTTGCTGG - Intergenic
988084051 5:26450539-26450561 ACTTGTTGAGAGCCATTGGATGG - Intergenic
989053977 5:37348190-37348212 GCTACTAGGGAGCCTGTGGCAGG + Intronic
991659100 5:68932378-68932400 ATTTTGAGGAAGCCATTGGCAGG - Intergenic
994353373 5:98770302-98770324 CCTTCTTGGGAGCGAGTGGCTGG + Intronic
995510344 5:112902774-112902796 ACTTGTGGGGAGGCTTTGGCAGG - Intronic
997695934 5:135860737-135860759 ATTTCTAGGCAGCCTTGGGCAGG + Intronic
998226749 5:140333020-140333042 CCTTCTCGGTAGCAATTGGCAGG + Exonic
998330872 5:141325845-141325867 ACTACTAGGGAGCCTAAGGCAGG + Intergenic
998392418 5:141795761-141795783 CCTGCTAGGGGGCCATGGGCTGG - Intergenic
998467645 5:142358291-142358313 ACTTCCAGGGAGCTCTGGGCCGG + Intergenic
998848381 5:146332613-146332635 ACTTCTAGGGAGTTATTGCGAGG + Intronic
1006182862 6:32164432-32164454 ACTTCTAGGGAGCCCTTTGCTGG + Intronic
1007202018 6:40117512-40117534 AGTTCTAGGGAGTCAAAGGCAGG - Intergenic
1009234084 6:61101842-61101864 ACTTCTTGGGATCTCTTGGCAGG - Intergenic
1009958117 6:70481519-70481541 ACTGCTAGGGAGCCTGAGGCAGG + Intronic
1016441969 6:144094038-144094060 ACCTCTGAGGAGCCATTGGAAGG - Intergenic
1029516927 7:101030332-101030354 ACTACTTGGGAGCCAGAGGCAGG - Intronic
1031411826 7:121448570-121448592 ACTACTAGGGAGGCAGAGGCAGG + Intergenic
1032315651 7:130836096-130836118 ACTCCTAGGCAGCCACTGGTGGG - Intergenic
1035346427 7:158202635-158202657 CCATTTAGGGAGGCATTGGCTGG - Intronic
1039938061 8:42065261-42065283 ACTACTAGGGAGCCTGAGGCAGG - Intergenic
1040446135 8:47495592-47495614 ATATCTAAGGAGCCATTGCCTGG + Intronic
1040683440 8:49841910-49841932 AATTCTAGGTAGACAGTGGCAGG + Intergenic
1044886068 8:96778951-96778973 GCTTCTCGGGAGGCATAGGCAGG + Intronic
1048353623 8:133635568-133635590 AATGATAGGGAGCCATTGGAGGG + Intergenic
1053171522 9:35889587-35889609 ACTACTAGGGAGGCAGGGGCAGG - Intergenic
1055042825 9:71893741-71893763 ACCTCTAGGTAGCTATTGGATGG - Intronic
1056104014 9:83329110-83329132 ATTTCTAGGGAGGGATGGGCTGG - Intronic
1057297541 9:93858290-93858312 TATTCTAGGGAGCCATTGATGGG - Intergenic
1060260825 9:122072227-122072249 AGCTCTAGGGAGCCATTGGAAGG - Intronic
1061807798 9:133146154-133146176 ACATCATGGGAGCCATTGGAAGG - Intronic
1190527896 X:51346351-51346373 ACTACTACAGAGCCCTTGGCAGG - Intergenic
1191103808 X:56759933-56759955 AGTTCCAAGGTGCCATTGGCTGG - Intergenic
1195375041 X:104218759-104218781 CATTATAGGGAGCCATTGACAGG + Intergenic
1197721812 X:129750460-129750482 GCTTCTAGGGAGCACTTGGCAGG + Exonic