ID: 1108693857

View in Genome Browser
Species Human (GRCh38)
Location 13:52885427-52885449
Sequence CCTCTGCTTAGTTTCAGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108693857_1108693861 1 Left 1108693857 13:52885427-52885449 CCCCTGCTGAAACTAAGCAGAGG No data
Right 1108693861 13:52885451-52885473 ACCATCTACCCAGAAAAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108693857 Original CRISPR CCTCTGCTTAGTTTCAGCAG GGG (reversed) Intergenic