ID: 1108693859

View in Genome Browser
Species Human (GRCh38)
Location 13:52885428-52885450
Sequence GCCTCTGCTTAGTTTCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108693859_1108693861 0 Left 1108693859 13:52885428-52885450 CCCTGCTGAAACTAAGCAGAGGC No data
Right 1108693861 13:52885451-52885473 ACCATCTACCCAGAAAAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108693859 Original CRISPR GCCTCTGCTTAGTTTCAGCA GGG (reversed) Intergenic
No off target data available for this crispr