ID: 1108693860

View in Genome Browser
Species Human (GRCh38)
Location 13:52885429-52885451
Sequence TGCCTCTGCTTAGTTTCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108693860_1108693861 -1 Left 1108693860 13:52885429-52885451 CCTGCTGAAACTAAGCAGAGGCA No data
Right 1108693861 13:52885451-52885473 ACCATCTACCCAGAAAAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108693860 Original CRISPR TGCCTCTGCTTAGTTTCAGC AGG (reversed) Intergenic