ID: 1108697141

View in Genome Browser
Species Human (GRCh38)
Location 13:52912538-52912560
Sequence CTGCTGCTCTAGAGAAATAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108697141_1108697148 24 Left 1108697141 13:52912538-52912560 CCCTTATTTCTCTAGAGCAGCAG No data
Right 1108697148 13:52912585-52912607 TTAGTCATGTTGGAGAGTGGGGG No data
1108697141_1108697146 22 Left 1108697141 13:52912538-52912560 CCCTTATTTCTCTAGAGCAGCAG No data
Right 1108697146 13:52912583-52912605 AATTAGTCATGTTGGAGAGTGGG No data
1108697141_1108697149 25 Left 1108697141 13:52912538-52912560 CCCTTATTTCTCTAGAGCAGCAG No data
Right 1108697149 13:52912586-52912608 TAGTCATGTTGGAGAGTGGGGGG No data
1108697141_1108697144 14 Left 1108697141 13:52912538-52912560 CCCTTATTTCTCTAGAGCAGCAG No data
Right 1108697144 13:52912575-52912597 TGATAATGAATTAGTCATGTTGG No data
1108697141_1108697147 23 Left 1108697141 13:52912538-52912560 CCCTTATTTCTCTAGAGCAGCAG No data
Right 1108697147 13:52912584-52912606 ATTAGTCATGTTGGAGAGTGGGG No data
1108697141_1108697145 21 Left 1108697141 13:52912538-52912560 CCCTTATTTCTCTAGAGCAGCAG No data
Right 1108697145 13:52912582-52912604 GAATTAGTCATGTTGGAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108697141 Original CRISPR CTGCTGCTCTAGAGAAATAA GGG (reversed) Intergenic
No off target data available for this crispr