ID: 1108698527

View in Genome Browser
Species Human (GRCh38)
Location 13:52924326-52924348
Sequence ACCAAAAATGTCTCTAGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108698527_1108698529 -9 Left 1108698527 13:52924326-52924348 CCATGTCTAGAGACATTTTTGGT No data
Right 1108698529 13:52924340-52924362 ATTTTTGGTTGTTACCACTAGGG No data
1108698527_1108698531 16 Left 1108698527 13:52924326-52924348 CCATGTCTAGAGACATTTTTGGT No data
Right 1108698531 13:52924365-52924387 TGAAACCCCTACCACCTAGCAGG No data
1108698527_1108698536 27 Left 1108698527 13:52924326-52924348 CCATGTCTAGAGACATTTTTGGT No data
Right 1108698536 13:52924376-52924398 CCACCTAGCAGGTAGAGTCCAGG No data
1108698527_1108698528 -10 Left 1108698527 13:52924326-52924348 CCATGTCTAGAGACATTTTTGGT No data
Right 1108698528 13:52924339-52924361 CATTTTTGGTTGTTACCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108698527 Original CRISPR ACCAAAAATGTCTCTAGACA TGG (reversed) Intergenic
No off target data available for this crispr