ID: 1108701453

View in Genome Browser
Species Human (GRCh38)
Location 13:52947797-52947819
Sequence CTCCAGGGGCAGGGGCGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108701453_1108701468 17 Left 1108701453 13:52947797-52947819 CCCTCCCGCCCCTGCCCCTGGAG No data
Right 1108701468 13:52947837-52947859 GGTGGTATACTCTGTGAGGAAGG No data
1108701453_1108701465 -4 Left 1108701453 13:52947797-52947819 CCCTCCCGCCCCTGCCCCTGGAG No data
Right 1108701465 13:52947816-52947838 GGAGTCAGGGAAGCAGAGAGTGG No data
1108701453_1108701466 -1 Left 1108701453 13:52947797-52947819 CCCTCCCGCCCCTGCCCCTGGAG No data
Right 1108701466 13:52947819-52947841 GTCAGGGAAGCAGAGAGTGGTGG No data
1108701453_1108701467 13 Left 1108701453 13:52947797-52947819 CCCTCCCGCCCCTGCCCCTGGAG No data
Right 1108701467 13:52947833-52947855 GAGTGGTGGTATACTCTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108701453 Original CRISPR CTCCAGGGGCAGGGGCGGGA GGG (reversed) Intergenic
No off target data available for this crispr