ID: 1108701454

View in Genome Browser
Species Human (GRCh38)
Location 13:52947798-52947820
Sequence ACTCCAGGGGCAGGGGCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108701454_1108701466 -2 Left 1108701454 13:52947798-52947820 CCTCCCGCCCCTGCCCCTGGAGT No data
Right 1108701466 13:52947819-52947841 GTCAGGGAAGCAGAGAGTGGTGG No data
1108701454_1108701468 16 Left 1108701454 13:52947798-52947820 CCTCCCGCCCCTGCCCCTGGAGT No data
Right 1108701468 13:52947837-52947859 GGTGGTATACTCTGTGAGGAAGG No data
1108701454_1108701465 -5 Left 1108701454 13:52947798-52947820 CCTCCCGCCCCTGCCCCTGGAGT No data
Right 1108701465 13:52947816-52947838 GGAGTCAGGGAAGCAGAGAGTGG No data
1108701454_1108701467 12 Left 1108701454 13:52947798-52947820 CCTCCCGCCCCTGCCCCTGGAGT No data
Right 1108701467 13:52947833-52947855 GAGTGGTGGTATACTCTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108701454 Original CRISPR ACTCCAGGGGCAGGGGCGGG AGG (reversed) Intergenic
No off target data available for this crispr