ID: 1108701464

View in Genome Browser
Species Human (GRCh38)
Location 13:52947813-52947835
Sequence CTCTCTGCTTCCCTGACTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108701464_1108701469 20 Left 1108701464 13:52947813-52947835 CCTGGAGTCAGGGAAGCAGAGAG No data
Right 1108701469 13:52947856-52947878 AAGGCCAGATTGTCCTCTCAAGG No data
1108701464_1108701472 30 Left 1108701464 13:52947813-52947835 CCTGGAGTCAGGGAAGCAGAGAG No data
Right 1108701472 13:52947866-52947888 TGTCCTCTCAAGGAAGAGGCTGG No data
1108701464_1108701468 1 Left 1108701464 13:52947813-52947835 CCTGGAGTCAGGGAAGCAGAGAG No data
Right 1108701468 13:52947837-52947859 GGTGGTATACTCTGTGAGGAAGG No data
1108701464_1108701467 -3 Left 1108701464 13:52947813-52947835 CCTGGAGTCAGGGAAGCAGAGAG No data
Right 1108701467 13:52947833-52947855 GAGTGGTGGTATACTCTGTGAGG No data
1108701464_1108701471 26 Left 1108701464 13:52947813-52947835 CCTGGAGTCAGGGAAGCAGAGAG No data
Right 1108701471 13:52947862-52947884 AGATTGTCCTCTCAAGGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108701464 Original CRISPR CTCTCTGCTTCCCTGACTCC AGG (reversed) Intergenic
No off target data available for this crispr