ID: 1108701468

View in Genome Browser
Species Human (GRCh38)
Location 13:52947837-52947859
Sequence GGTGGTATACTCTGTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108701454_1108701468 16 Left 1108701454 13:52947798-52947820 CCTCCCGCCCCTGCCCCTGGAGT No data
Right 1108701468 13:52947837-52947859 GGTGGTATACTCTGTGAGGAAGG No data
1108701455_1108701468 13 Left 1108701455 13:52947801-52947823 CCCGCCCCTGCCCCTGGAGTCAG No data
Right 1108701468 13:52947837-52947859 GGTGGTATACTCTGTGAGGAAGG No data
1108701456_1108701468 12 Left 1108701456 13:52947802-52947824 CCGCCCCTGCCCCTGGAGTCAGG No data
Right 1108701468 13:52947837-52947859 GGTGGTATACTCTGTGAGGAAGG No data
1108701460_1108701468 8 Left 1108701460 13:52947806-52947828 CCCTGCCCCTGGAGTCAGGGAAG No data
Right 1108701468 13:52947837-52947859 GGTGGTATACTCTGTGAGGAAGG No data
1108701453_1108701468 17 Left 1108701453 13:52947797-52947819 CCCTCCCGCCCCTGCCCCTGGAG No data
Right 1108701468 13:52947837-52947859 GGTGGTATACTCTGTGAGGAAGG No data
1108701464_1108701468 1 Left 1108701464 13:52947813-52947835 CCTGGAGTCAGGGAAGCAGAGAG No data
Right 1108701468 13:52947837-52947859 GGTGGTATACTCTGTGAGGAAGG No data
1108701462_1108701468 3 Left 1108701462 13:52947811-52947833 CCCCTGGAGTCAGGGAAGCAGAG No data
Right 1108701468 13:52947837-52947859 GGTGGTATACTCTGTGAGGAAGG No data
1108701461_1108701468 7 Left 1108701461 13:52947807-52947829 CCTGCCCCTGGAGTCAGGGAAGC No data
Right 1108701468 13:52947837-52947859 GGTGGTATACTCTGTGAGGAAGG No data
1108701463_1108701468 2 Left 1108701463 13:52947812-52947834 CCCTGGAGTCAGGGAAGCAGAGA No data
Right 1108701468 13:52947837-52947859 GGTGGTATACTCTGTGAGGAAGG No data
1108701459_1108701468 9 Left 1108701459 13:52947805-52947827 CCCCTGCCCCTGGAGTCAGGGAA No data
Right 1108701468 13:52947837-52947859 GGTGGTATACTCTGTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108701468 Original CRISPR GGTGGTATACTCTGTGAGGA AGG Intergenic
No off target data available for this crispr