ID: 1108701745

View in Genome Browser
Species Human (GRCh38)
Location 13:52949787-52949809
Sequence ACTCCTGCTGGATCCGTCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108701742_1108701745 -6 Left 1108701742 13:52949770-52949792 CCAGCAATTATTAATTCACTCCT No data
Right 1108701745 13:52949787-52949809 ACTCCTGCTGGATCCGTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108701745 Original CRISPR ACTCCTGCTGGATCCGTCTT GGG Intergenic