ID: 1108704534

View in Genome Browser
Species Human (GRCh38)
Location 13:52973360-52973382
Sequence TCTGGGGACCCTTGCTGAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108704528_1108704534 13 Left 1108704528 13:52973324-52973346 CCAACATGAAACAGAAAGTTCAG No data
Right 1108704534 13:52973360-52973382 TCTGGGGACCCTTGCTGAATTGG No data
1108704527_1108704534 28 Left 1108704527 13:52973309-52973331 CCTTTGTATTCTTCTCCAACATG No data
Right 1108704534 13:52973360-52973382 TCTGGGGACCCTTGCTGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108704534 Original CRISPR TCTGGGGACCCTTGCTGAAT TGG Intergenic
No off target data available for this crispr