ID: 1108705068

View in Genome Browser
Species Human (GRCh38)
Location 13:52977896-52977918
Sequence GAGCTGAGCCTCCAAGAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108705068_1108705070 7 Left 1108705068 13:52977896-52977918 CCAATCTCTTGGAGGCTCAGCTC No data
Right 1108705070 13:52977926-52977948 AGTAGCACTGCCTGTCTCAGAGG No data
1108705068_1108705076 22 Left 1108705068 13:52977896-52977918 CCAATCTCTTGGAGGCTCAGCTC No data
Right 1108705076 13:52977941-52977963 CTCAGAGGGCTGCAGTGAGGGGG No data
1108705068_1108705073 19 Left 1108705068 13:52977896-52977918 CCAATCTCTTGGAGGCTCAGCTC No data
Right 1108705073 13:52977938-52977960 TGTCTCAGAGGGCTGCAGTGAGG No data
1108705068_1108705074 20 Left 1108705068 13:52977896-52977918 CCAATCTCTTGGAGGCTCAGCTC No data
Right 1108705074 13:52977939-52977961 GTCTCAGAGGGCTGCAGTGAGGG No data
1108705068_1108705075 21 Left 1108705068 13:52977896-52977918 CCAATCTCTTGGAGGCTCAGCTC No data
Right 1108705075 13:52977940-52977962 TCTCAGAGGGCTGCAGTGAGGGG No data
1108705068_1108705071 8 Left 1108705068 13:52977896-52977918 CCAATCTCTTGGAGGCTCAGCTC No data
Right 1108705071 13:52977927-52977949 GTAGCACTGCCTGTCTCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108705068 Original CRISPR GAGCTGAGCCTCCAAGAGAT TGG (reversed) Intergenic
No off target data available for this crispr