ID: 1108705281

View in Genome Browser
Species Human (GRCh38)
Location 13:52979895-52979917
Sequence CCTAGGCTTCCACAGATAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108705281_1108705287 23 Left 1108705281 13:52979895-52979917 CCAATTATCTGTGGAAGCCTAGG No data
Right 1108705287 13:52979941-52979963 CCTTATTTGCAAAATGTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108705281 Original CRISPR CCTAGGCTTCCACAGATAAT TGG (reversed) Intergenic
No off target data available for this crispr