ID: 1108705281 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:52979895-52979917 |
| Sequence | CCTAGGCTTCCACAGATAAT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1108705281_1108705287 | 23 | Left | 1108705281 | 13:52979895-52979917 | CCAATTATCTGTGGAAGCCTAGG | No data | ||
| Right | 1108705287 | 13:52979941-52979963 | CCTTATTTGCAAAATGTAGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1108705281 | Original CRISPR | CCTAGGCTTCCACAGATAAT TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||