ID: 1108705283

View in Genome Browser
Species Human (GRCh38)
Location 13:52979912-52979934
Sequence AAGCAGAGAATATCTTGCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108705283_1108705288 27 Left 1108705283 13:52979912-52979934 CCTAGGCAAGATATTCTCTGCTT No data
Right 1108705288 13:52979962-52979984 GGTAGTAGTACCTTCCTTAGAGG No data
1108705283_1108705287 6 Left 1108705283 13:52979912-52979934 CCTAGGCAAGATATTCTCTGCTT No data
Right 1108705287 13:52979941-52979963 CCTTATTTGCAAAATGTAGATGG No data
1108705283_1108705289 28 Left 1108705283 13:52979912-52979934 CCTAGGCAAGATATTCTCTGCTT No data
Right 1108705289 13:52979963-52979985 GTAGTAGTACCTTCCTTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108705283 Original CRISPR AAGCAGAGAATATCTTGCCT AGG (reversed) Intergenic
No off target data available for this crispr