ID: 1108705287

View in Genome Browser
Species Human (GRCh38)
Location 13:52979941-52979963
Sequence CCTTATTTGCAAAATGTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108705281_1108705287 23 Left 1108705281 13:52979895-52979917 CCAATTATCTGTGGAAGCCTAGG No data
Right 1108705287 13:52979941-52979963 CCTTATTTGCAAAATGTAGATGG No data
1108705283_1108705287 6 Left 1108705283 13:52979912-52979934 CCTAGGCAAGATATTCTCTGCTT No data
Right 1108705287 13:52979941-52979963 CCTTATTTGCAAAATGTAGATGG No data
1108705280_1108705287 26 Left 1108705280 13:52979892-52979914 CCACCAATTATCTGTGGAAGCCT No data
Right 1108705287 13:52979941-52979963 CCTTATTTGCAAAATGTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108705287 Original CRISPR CCTTATTTGCAAAATGTAGA TGG Intergenic
No off target data available for this crispr