ID: 1108707254

View in Genome Browser
Species Human (GRCh38)
Location 13:53000860-53000882
Sequence TCTGGCCTGCAGATGGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108707247_1108707254 26 Left 1108707247 13:53000811-53000833 CCACTCCAGGTCTAAGTCTGGCT No data
Right 1108707254 13:53000860-53000882 TCTGGCCTGCAGATGGAGCAAGG No data
1108707248_1108707254 21 Left 1108707248 13:53000816-53000838 CCAGGTCTAAGTCTGGCTCTAGG No data
Right 1108707254 13:53000860-53000882 TCTGGCCTGCAGATGGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108707254 Original CRISPR TCTGGCCTGCAGATGGAGCA AGG Intergenic
No off target data available for this crispr